ID: 944329195

View in Genome Browser
Species Human (GRCh38)
Location 2:198445425-198445447
Sequence GCTGATACTAAAGGAAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944329195_944329200 9 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329200 2:198445457-198445479 AGATCTTCTTCAAGACTAGGTGG No data
944329195_944329203 26 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329203 2:198445474-198445496 AGGTGGGATACCCCAGCCCAGGG No data
944329195_944329199 6 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329199 2:198445454-198445476 GTTAGATCTTCTTCAAGACTAGG No data
944329195_944329205 30 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329205 2:198445478-198445500 GGGATACCCCAGCCCAGGGTGGG No data
944329195_944329202 25 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329202 2:198445473-198445495 TAGGTGGGATACCCCAGCCCAGG No data
944329195_944329204 29 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG No data
944329195_944329201 10 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329201 2:198445458-198445480 GATCTTCTTCAAGACTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944329195 Original CRISPR GCTGATACTAAAGGAAAATA GGG (reversed) Intronic
No off target data available for this crispr