ID: 944329204

View in Genome Browser
Species Human (GRCh38)
Location 2:198445477-198445499
Sequence TGGGATACCCCAGCCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944329196_944329204 28 Left 944329196 2:198445426-198445448 CCTATTTTCCTTTAGTATCAGCT No data
Right 944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG No data
944329198_944329204 20 Left 944329198 2:198445434-198445456 CCTTTAGTATCAGCTAAGAGGTT No data
Right 944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG No data
944329195_944329204 29 Left 944329195 2:198445425-198445447 CCCTATTTTCCTTTAGTATCAGC No data
Right 944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944329204 Original CRISPR TGGGATACCCCAGCCCAGGG TGG Intronic
No off target data available for this crispr