ID: 944330403 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:198458750-198458772 |
Sequence | CTAAGCTCATTTCTTTCTTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
944330403_944330407 | 14 | Left | 944330403 | 2:198458750-198458772 | CCACAAGAAAGAAATGAGCTTAG | No data | ||
Right | 944330407 | 2:198458787-198458809 | ATTTACATGCAGAATTTAGAGGG | No data | ||||
944330403_944330406 | 13 | Left | 944330403 | 2:198458750-198458772 | CCACAAGAAAGAAATGAGCTTAG | No data | ||
Right | 944330406 | 2:198458786-198458808 | AATTTACATGCAGAATTTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
944330403 | Original CRISPR | CTAAGCTCATTTCTTTCTTG TGG (reversed) | Intronic | ||
No off target data available for this crispr |