ID: 944330407

View in Genome Browser
Species Human (GRCh38)
Location 2:198458787-198458809
Sequence ATTTACATGCAGAATTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944330403_944330407 14 Left 944330403 2:198458750-198458772 CCACAAGAAAGAAATGAGCTTAG No data
Right 944330407 2:198458787-198458809 ATTTACATGCAGAATTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944330407 Original CRISPR ATTTACATGCAGAATTTAGA GGG Intronic
No off target data available for this crispr