ID: 944334847

View in Genome Browser
Species Human (GRCh38)
Location 2:198520366-198520388
Sequence GGACTATGGACACCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944334847_944334850 -8 Left 944334847 2:198520366-198520388 CCTGCTTTTGGTGTCCATAGTCC No data
Right 944334850 2:198520381-198520403 CATAGTCCTTTTCATGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944334847 Original CRISPR GGACTATGGACACCAAAAGC AGG (reversed) Intronic
No off target data available for this crispr