ID: 944334850

View in Genome Browser
Species Human (GRCh38)
Location 2:198520381-198520403
Sequence CATAGTCCTTTTCATGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944334844_944334850 30 Left 944334844 2:198520328-198520350 CCTTCTTCTATATGGTCTATGGT No data
Right 944334850 2:198520381-198520403 CATAGTCCTTTTCATGGTCCTGG No data
944334847_944334850 -8 Left 944334847 2:198520366-198520388 CCTGCTTTTGGTGTCCATAGTCC No data
Right 944334850 2:198520381-198520403 CATAGTCCTTTTCATGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944334850 Original CRISPR CATAGTCCTTTTCATGGTCC TGG Intronic
No off target data available for this crispr