ID: 944336973

View in Genome Browser
Species Human (GRCh38)
Location 2:198545535-198545557
Sequence CACCTCTTACTCCTATCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944336973_944336974 23 Left 944336973 2:198545535-198545557 CCTCTGGATAGGAGTAAGAGGTG No data
Right 944336974 2:198545581-198545603 TTAACACAGAATGATGACTCAGG No data
944336973_944336975 24 Left 944336973 2:198545535-198545557 CCTCTGGATAGGAGTAAGAGGTG No data
Right 944336975 2:198545582-198545604 TAACACAGAATGATGACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944336973 Original CRISPR CACCTCTTACTCCTATCCAG AGG (reversed) Intronic
No off target data available for this crispr