ID: 944338075

View in Genome Browser
Species Human (GRCh38)
Location 2:198561513-198561535
Sequence CTATTTCTGTCAAGAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944338075_944338076 0 Left 944338075 2:198561513-198561535 CCAGACACTCTTGACAGAAATAG No data
Right 944338076 2:198561536-198561558 AAAAAATCCTAAAATTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944338075 Original CRISPR CTATTTCTGTCAAGAGTGTC TGG (reversed) Intronic
No off target data available for this crispr