ID: 944353668

View in Genome Browser
Species Human (GRCh38)
Location 2:198759514-198759536
Sequence CTTGCTACTTAGGGTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944353668_944353674 -2 Left 944353668 2:198759514-198759536 CCAACCACACCCTAAGTAGCAAG No data
Right 944353674 2:198759535-198759557 AGACTTTAGGAAAACACCTTGGG No data
944353668_944353673 -3 Left 944353668 2:198759514-198759536 CCAACCACACCCTAAGTAGCAAG No data
Right 944353673 2:198759534-198759556 AAGACTTTAGGAAAACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944353668 Original CRISPR CTTGCTACTTAGGGTGTGGT TGG (reversed) Intergenic
No off target data available for this crispr