ID: 944353668 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:198759514-198759536 |
Sequence | CTTGCTACTTAGGGTGTGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
944353668_944353673 | -3 | Left | 944353668 | 2:198759514-198759536 | CCAACCACACCCTAAGTAGCAAG | No data | ||
Right | 944353673 | 2:198759534-198759556 | AAGACTTTAGGAAAACACCTTGG | No data | ||||
944353668_944353674 | -2 | Left | 944353668 | 2:198759514-198759536 | CCAACCACACCCTAAGTAGCAAG | No data | ||
Right | 944353674 | 2:198759535-198759557 | AGACTTTAGGAAAACACCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
944353668 | Original CRISPR | CTTGCTACTTAGGGTGTGGT TGG (reversed) | Intergenic | ||