ID: 944353673

View in Genome Browser
Species Human (GRCh38)
Location 2:198759534-198759556
Sequence AAGACTTTAGGAAAACACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944353669_944353673 -7 Left 944353669 2:198759518-198759540 CCACACCCTAAGTAGCAAGACTT No data
Right 944353673 2:198759534-198759556 AAGACTTTAGGAAAACACCTTGG No data
944353667_944353673 1 Left 944353667 2:198759510-198759532 CCTACCAACCACACCCTAAGTAG No data
Right 944353673 2:198759534-198759556 AAGACTTTAGGAAAACACCTTGG No data
944353666_944353673 13 Left 944353666 2:198759498-198759520 CCATACTGCAGACCTACCAACCA No data
Right 944353673 2:198759534-198759556 AAGACTTTAGGAAAACACCTTGG No data
944353668_944353673 -3 Left 944353668 2:198759514-198759536 CCAACCACACCCTAAGTAGCAAG No data
Right 944353673 2:198759534-198759556 AAGACTTTAGGAAAACACCTTGG No data
944353665_944353673 23 Left 944353665 2:198759488-198759510 CCAGGTGATGCCATACTGCAGAC No data
Right 944353673 2:198759534-198759556 AAGACTTTAGGAAAACACCTTGG No data
944353664_944353673 24 Left 944353664 2:198759487-198759509 CCCAGGTGATGCCATACTGCAGA No data
Right 944353673 2:198759534-198759556 AAGACTTTAGGAAAACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944353673 Original CRISPR AAGACTTTAGGAAAACACCT TGG Intergenic
No off target data available for this crispr