ID: 944355145

View in Genome Browser
Species Human (GRCh38)
Location 2:198778728-198778750
Sequence TAGGAAAAGCATCAAGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944355145_944355150 2 Left 944355145 2:198778728-198778750 CCTAACTCTTGATGCTTTTCCTA No data
Right 944355150 2:198778753-198778775 ACAAAGAACAAGTGGATGGGTGG No data
944355145_944355149 -1 Left 944355145 2:198778728-198778750 CCTAACTCTTGATGCTTTTCCTA No data
Right 944355149 2:198778750-198778772 AAGACAAAGAACAAGTGGATGGG No data
944355145_944355146 -6 Left 944355145 2:198778728-198778750 CCTAACTCTTGATGCTTTTCCTA No data
Right 944355146 2:198778745-198778767 TTCCTAAGACAAAGAACAAGTGG No data
944355145_944355148 -2 Left 944355145 2:198778728-198778750 CCTAACTCTTGATGCTTTTCCTA No data
Right 944355148 2:198778749-198778771 TAAGACAAAGAACAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944355145 Original CRISPR TAGGAAAAGCATCAAGAGTT AGG (reversed) Intergenic
No off target data available for this crispr