ID: 944358339

View in Genome Browser
Species Human (GRCh38)
Location 2:198820630-198820652
Sequence CCAGTTTACCAGCACACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944358339_944358342 15 Left 944358339 2:198820630-198820652 CCAGGGGTGTGCTGGTAAACTGG No data
Right 944358342 2:198820668-198820690 ATAATTGTATAAGTCCCGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944358339 Original CRISPR CCAGTTTACCAGCACACCCC TGG (reversed) Intergenic
No off target data available for this crispr