ID: 944360098

View in Genome Browser
Species Human (GRCh38)
Location 2:198844119-198844141
Sequence TTGTTGCTAGATCCAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944360094_944360098 24 Left 944360094 2:198844072-198844094 CCATTACTACACTAAAAGCACTA No data
Right 944360098 2:198844119-198844141 TTGTTGCTAGATCCAATGGGTGG No data
944360093_944360098 25 Left 944360093 2:198844071-198844093 CCCATTACTACACTAAAAGCACT No data
Right 944360098 2:198844119-198844141 TTGTTGCTAGATCCAATGGGTGG No data
944360092_944360098 28 Left 944360092 2:198844068-198844090 CCTCCCATTACTACACTAAAAGC No data
Right 944360098 2:198844119-198844141 TTGTTGCTAGATCCAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944360098 Original CRISPR TTGTTGCTAGATCCAATGGG TGG Intergenic
No off target data available for this crispr