ID: 944365807

View in Genome Browser
Species Human (GRCh38)
Location 2:198918179-198918201
Sequence GTAGTGATTGCCATCATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944365806_944365807 29 Left 944365806 2:198918127-198918149 CCAGCTTGACATATATATGCTGT No data
Right 944365807 2:198918179-198918201 GTAGTGATTGCCATCATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944365807 Original CRISPR GTAGTGATTGCCATCATTAA TGG Intergenic
No off target data available for this crispr