ID: 944370784

View in Genome Browser
Species Human (GRCh38)
Location 2:198981025-198981047
Sequence AAGGGGTTCGAGGATGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944370776_944370784 28 Left 944370776 2:198980974-198980996 CCAGGGGACATTTGGCAAAGTCC No data
Right 944370784 2:198981025-198981047 AAGGGGTTCGAGGATGCTACTGG No data
944370777_944370784 7 Left 944370777 2:198980995-198981017 CCAAAGATATTTTGTGTTGTAAC No data
Right 944370784 2:198981025-198981047 AAGGGGTTCGAGGATGCTACTGG No data
944370774_944370784 30 Left 944370774 2:198980972-198980994 CCCCAGGGGACATTTGGCAAAGT No data
Right 944370784 2:198981025-198981047 AAGGGGTTCGAGGATGCTACTGG No data
944370775_944370784 29 Left 944370775 2:198980973-198980995 CCCAGGGGACATTTGGCAAAGTC 0: 4
1: 144
2: 514
3: 963
4: 1335
Right 944370784 2:198981025-198981047 AAGGGGTTCGAGGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944370784 Original CRISPR AAGGGGTTCGAGGATGCTAC TGG Intergenic
No off target data available for this crispr