ID: 944380305

View in Genome Browser
Species Human (GRCh38)
Location 2:199101536-199101558
Sequence GATCTCCTTGGGTATATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944380302_944380305 -6 Left 944380302 2:199101519-199101541 CCTTCAACATCACATAAGATCTC No data
Right 944380305 2:199101536-199101558 GATCTCCTTGGGTATATAAAAGG No data
944380301_944380305 0 Left 944380301 2:199101513-199101535 CCTCTGCCTTCAACATCACATAA No data
Right 944380305 2:199101536-199101558 GATCTCCTTGGGTATATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944380305 Original CRISPR GATCTCCTTGGGTATATAAA AGG Intergenic
No off target data available for this crispr