ID: 944381716

View in Genome Browser
Species Human (GRCh38)
Location 2:199118154-199118176
Sequence GGGAAATGGTCTTCTTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944381716_944381724 28 Left 944381716 2:199118154-199118176 CCTATACAAGAAGACCATTTCCC No data
Right 944381724 2:199118205-199118227 CCATTGAAATAGCAATCAATGGG No data
944381716_944381722 27 Left 944381716 2:199118154-199118176 CCTATACAAGAAGACCATTTCCC No data
Right 944381722 2:199118204-199118226 TCCATTGAAATAGCAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944381716 Original CRISPR GGGAAATGGTCTTCTTGTAT AGG (reversed) Intergenic
No off target data available for this crispr