ID: 944395318

View in Genome Browser
Species Human (GRCh38)
Location 2:199259992-199260014
Sequence GGGGAAGTAAGTGTCCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944395318_944395327 26 Left 944395318 2:199259992-199260014 CCTCAGAGGACACTTACTTCCCC No data
Right 944395327 2:199260041-199260063 CCTTGGATTTTAGAATTTTTTGG No data
944395318_944395325 9 Left 944395318 2:199259992-199260014 CCTCAGAGGACACTTACTTCCCC No data
Right 944395325 2:199260024-199260046 GGATCGACATTATTTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944395318 Original CRISPR GGGGAAGTAAGTGTCCTCTG AGG (reversed) Intergenic
No off target data available for this crispr