ID: 944395321

View in Genome Browser
Species Human (GRCh38)
Location 2:199260011-199260033
Sequence ATGTCGATCCACCGTGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944395321_944395327 7 Left 944395321 2:199260011-199260033 CCCCATCCACGGTGGATCGACAT No data
Right 944395327 2:199260041-199260063 CCTTGGATTTTAGAATTTTTTGG No data
944395321_944395325 -10 Left 944395321 2:199260011-199260033 CCCCATCCACGGTGGATCGACAT No data
Right 944395325 2:199260024-199260046 GGATCGACATTATTTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944395321 Original CRISPR ATGTCGATCCACCGTGGATG GGG (reversed) Intergenic
No off target data available for this crispr