ID: 944395325

View in Genome Browser
Species Human (GRCh38)
Location 2:199260024-199260046
Sequence GGATCGACATTATTTCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944395318_944395325 9 Left 944395318 2:199259992-199260014 CCTCAGAGGACACTTACTTCCCC No data
Right 944395325 2:199260024-199260046 GGATCGACATTATTTCACCTTGG No data
944395321_944395325 -10 Left 944395321 2:199260011-199260033 CCCCATCCACGGTGGATCGACAT No data
Right 944395325 2:199260024-199260046 GGATCGACATTATTTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944395325 Original CRISPR GGATCGACATTATTTCACCT TGG Intergenic
No off target data available for this crispr