ID: 944396757

View in Genome Browser
Species Human (GRCh38)
Location 2:199276749-199276771
Sequence CATTTTGAAAAAAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944396757_944396765 -8 Left 944396757 2:199276749-199276771 CCTTTTTCCCTTTTTTCAAAATG No data
Right 944396765 2:199276764-199276786 TCAAAATGGGCCCAGTGGAGGGG No data
944396757_944396764 -9 Left 944396757 2:199276749-199276771 CCTTTTTCCCTTTTTTCAAAATG No data
Right 944396764 2:199276763-199276785 TTCAAAATGGGCCCAGTGGAGGG No data
944396757_944396763 -10 Left 944396757 2:199276749-199276771 CCTTTTTCCCTTTTTTCAAAATG No data
Right 944396763 2:199276762-199276784 TTTCAAAATGGGCCCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944396757 Original CRISPR CATTTTGAAAAAAGGGAAAA AGG (reversed) Intronic
No off target data available for this crispr