ID: 944398887

View in Genome Browser
Species Human (GRCh38)
Location 2:199302735-199302757
Sequence TTCCCTGGAAGATGTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944398884_944398887 27 Left 944398884 2:199302685-199302707 CCGGTAAGAGAATTTGTAAACAT No data
Right 944398887 2:199302735-199302757 TTCCCTGGAAGATGTCCTTCAGG No data
944398883_944398887 28 Left 944398883 2:199302684-199302706 CCCGGTAAGAGAATTTGTAAACA No data
Right 944398887 2:199302735-199302757 TTCCCTGGAAGATGTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944398887 Original CRISPR TTCCCTGGAAGATGTCCTTC AGG Intronic
No off target data available for this crispr