ID: 944402915

View in Genome Browser
Species Human (GRCh38)
Location 2:199348880-199348902
Sequence GATGCTGGTGAGCCAGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944402915 Original CRISPR GATGCTGGTGAGCCAGGAGC CGG Exonic
900327515 1:2116056-2116078 GATGACGGGGAGCCGGGAGCCGG - Intronic
900417381 1:2541221-2541243 GAGGCTGGGGAGGCGGGAGCAGG + Intergenic
900577914 1:3393549-3393571 GACGCTCTCGAGCCAGGAGCCGG + Intronic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
900927394 1:5714165-5714187 GGTGCTGGCCAGCCAGGGGCAGG + Intergenic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901842866 1:11964779-11964801 GCAGCAGGTCAGCCAGGAGCGGG + Exonic
901925011 1:12560582-12560604 CATGGTGGTGAGTGAGGAGCAGG - Intergenic
902080496 1:13817468-13817490 TCTGCTGGTGACCCACGAGCAGG + Intronic
902684916 1:18070109-18070131 GATTCTGGAGAGCAAGCAGCCGG - Intergenic
902693007 1:18121972-18121994 CATCCTGGTGACCCAGGACCTGG - Intronic
902943291 1:19815597-19815619 GATGCCAGTGAGCCAAGATCGGG - Intergenic
902975086 1:20082643-20082665 GTAGCTGGTCAGACAGGAGCAGG - Intronic
903280835 1:22248998-22249020 GAAGCTGGTGAGACTGGACCTGG + Intergenic
903299482 1:22368544-22368566 GATGCTGGCAGCCCAGGAGCTGG + Intergenic
903835766 1:26202401-26202423 GAAGCTGGTGAGACTGGAGGAGG + Intronic
903961200 1:27058947-27058969 GATGCTTGGGAGCCAGGATAGGG - Intergenic
904037292 1:27565563-27565585 GGCGCTGGTGAGCAAGGGGCGGG + Intronic
905033125 1:34900765-34900787 GATTGTGGAGGGCCAGGAGCAGG + Intronic
905227020 1:36485728-36485750 GGGGCTGGTGAGGCAGGAGAGGG - Intergenic
905244171 1:36601196-36601218 AACCCTGGAGAGCCAGGAGCTGG - Intergenic
905866429 1:41379509-41379531 GGGGCTGGGGAGCCAGGTGCAGG + Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
907422880 1:54358940-54358962 GACGCTCTTGAGTCAGGAGCTGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907785349 1:57606252-57606274 AACAGTGGTGAGCCAGGAGCAGG + Intronic
909014436 1:70367818-70367840 GAAGCTTCTGAGCCAGGAGAAGG - Exonic
909876671 1:80813680-80813702 GTTGGTGGTGAGTGAGGAGCAGG + Intergenic
911070798 1:93830504-93830526 GGAGCTTCTGAGCCAGGAGCAGG - Intronic
911079708 1:93916439-93916461 GGACCTGCTGAGCCAGGAGCGGG + Intergenic
911892276 1:103386632-103386654 GATGCCAGTGTGCCGGGAGCAGG + Intergenic
913160406 1:116139999-116140021 GAGGCTGGTGGTCCAAGAGCAGG - Intergenic
913598312 1:120398475-120398497 GATGCTGGTCAAACAGGATCTGG + Intergenic
914309593 1:146453371-146453393 GATGCTGGTCAAACAGGATCTGG + Intergenic
914512098 1:148343211-148343233 GATGCTGGTCAAACAGGATCTGG - Intergenic
914592517 1:149119768-149119790 GATGCTGGTCAAACAGGATCTGG - Intergenic
914689939 1:150016814-150016836 GATGTTGCTGAACAAGGAGCTGG + Intergenic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
915981830 1:160425192-160425214 GACATTGGTGAGCGAGGAGCCGG + Exonic
917972884 1:180219904-180219926 GGCACTGGTGAGCCAGGAGGAGG - Intergenic
919084813 1:192909514-192909536 GATGATGGTGAGGTAGGAGGTGG + Intergenic
919615696 1:199806010-199806032 GATGCAGCTCAGCCATGAGCTGG - Intergenic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
920943933 1:210510720-210510742 CATGCTGGTGAGGCAGGTACTGG - Intronic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
924166554 1:241289196-241289218 CATGATGGAGAGGCAGGAGCTGG - Intronic
924842732 1:247730760-247730782 GATGTTGGAGGGCCAGGAGAAGG + Intergenic
1062942586 10:1435243-1435265 GGTGTTGGTGAGACAAGAGCGGG + Intronic
1062978632 10:1703405-1703427 GATGCTGGTGAGCAGTGAGGAGG + Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064149334 10:12849634-12849656 GATGGTGGTGAGCAAGGGGGAGG + Intergenic
1064331674 10:14400131-14400153 GAGGCTGGTGAGAAAGGAGGAGG - Intronic
1066291186 10:34015742-34015764 CATTTTGGTGAGACAGGAGCAGG - Intergenic
1067190770 10:44066011-44066033 GTTGCTGTTGAGCCAGGTGTGGG - Intergenic
1072147198 10:92652201-92652223 GATTGTGGTGAGCCAAGATCAGG - Intronic
1072661092 10:97363970-97363992 CAGCCTGGTGAGCCAGGAGGGGG - Intronic
1073267284 10:102235290-102235312 GATGCTGCTGAGTGAGGAGAAGG + Intronic
1073683240 10:105727760-105727782 GGTGCTTCTGAGCCAGGAGAAGG - Intergenic
1074124465 10:110517043-110517065 GAGGAGGGGGAGCCAGGAGCAGG + Intergenic
1075430347 10:122374955-122374977 GGTGCTGGTGAGTGCGGAGCCGG + Intronic
1076084166 10:127610617-127610639 GACGACGGGGAGCCAGGAGCTGG - Intergenic
1077218168 11:1403730-1403752 CATGCTGGTGAGACAGAAGTGGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078536485 11:12179172-12179194 CAGGTTGGTGAGGCAGGAGCTGG - Intronic
1080285180 11:30602813-30602835 GATGCTGGTGACACAGTATCTGG - Intergenic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1082790724 11:57345138-57345160 GAAGCTGCAGAGCCAGGAGCTGG - Intronic
1083149383 11:60782403-60782425 CATGCTGGGGATCCAGGAGTGGG - Intergenic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083659349 11:64245103-64245125 CATTCTGTTGAGGCAGGAGCTGG + Intronic
1084466724 11:69327675-69327697 GATGGTGGTGAGGGAGGAGGAGG + Intronic
1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG + Exonic
1085021898 11:73215368-73215390 CATGGTGGGGAGCCAGAAGCAGG + Intergenic
1085790462 11:79493398-79493420 GATGGGGGTGAGGCAGAAGCAGG - Intergenic
1088613042 11:111597265-111597287 CATGTTTGTGTGCCAGGAGCGGG - Intergenic
1089662126 11:119992585-119992607 GAGGGTGGTGAGCCAGGCACTGG - Intergenic
1090777667 11:129979564-129979586 GTTGCTGGGGAGACAGGAACTGG - Intronic
1090920057 11:131199166-131199188 GATCCCTGTGAGCCAGGGGCTGG - Intergenic
1090937014 11:131352120-131352142 CATCCTGATGAGCCAGGATCTGG + Intergenic
1091546507 12:1504677-1504699 CATGCAGGTGAGGCAGGTGCAGG - Intergenic
1091695216 12:2623794-2623816 GGAGCTTGTGAGCCAGGGGCTGG - Intronic
1094142759 12:27198093-27198115 GCTGCTGTTGAGCTAGGGGCTGG - Intergenic
1095513959 12:42985151-42985173 GATGGTGGTGGGGCAGGACCTGG + Intergenic
1096045719 12:48560361-48560383 AGTGCTGCTGAGCCAGGAGGAGG - Intergenic
1096103895 12:48985706-48985728 GACGCTGGTGAGCGAGCAGCAGG + Intergenic
1096781797 12:53996099-53996121 GGTGCTGACGAGCCGGGAGCGGG + Intronic
1096997347 12:55847053-55847075 GATGCAGCAGAGCCTGGAGCAGG + Intergenic
1097191055 12:57219852-57219874 GGAGCTGGAGACCCAGGAGCGGG + Intronic
1100808284 12:98311075-98311097 GGTGCTGCTGAGCCAGGCACGGG - Intergenic
1101716837 12:107319339-107319361 GACGCTGGTGAGCCGGGCGCTGG + Exonic
1102505254 12:113380699-113380721 GATGCTGGTCAGACAGGCACAGG - Intronic
1103446565 12:120999037-120999059 GATGCAGGGGAGCCTGGAGGAGG - Intronic
1104598221 12:130134265-130134287 GGTGCTGGGGAGGGAGGAGCTGG - Intergenic
1104969693 12:132525630-132525652 GGTGCTGGGGTGCCGGGAGCAGG + Intronic
1106324983 13:28680386-28680408 GAGGGTGGTGTGCCAGGAGAGGG - Intergenic
1107939670 13:45372637-45372659 GATGCAGGAAAGCAAGGAGCAGG - Intergenic
1110404591 13:75135647-75135669 GATCATGGAGAGCGAGGAGCTGG + Intergenic
1111928971 13:94494132-94494154 GATCCTGGGGAGCCATGAGTGGG - Intergenic
1112809064 13:103196722-103196744 GAAGCTGGAGAGCCTGCAGCAGG - Intergenic
1113323908 13:109265279-109265301 GGAGCTGCTGAGCCAGGAGAAGG - Intergenic
1113482356 13:110630687-110630709 GATGCTGGTGTGGTAGGAGGAGG + Intronic
1113674124 13:112196373-112196395 GGTGCTGAGGAGGCAGGAGCAGG - Intergenic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1117313461 14:54551178-54551200 GGTGCTGCTGGGCCTGGAGCTGG - Intergenic
1119971910 14:78980190-78980212 AAGGCTGGTGACCCAGGAGTGGG - Intronic
1121357557 14:93228619-93228641 CATGCTGGTGAGCCCTGAGCTGG + Exonic
1121452257 14:94016479-94016501 GCTGCTCCTGAGCCAAGAGCAGG - Intergenic
1122310244 14:100789721-100789743 GTTGCTGTTGAGCCTGGTGCTGG + Intergenic
1122507346 14:102240078-102240100 GAAGCTTCTGAGCCAGGAGAAGG - Intronic
1122838281 14:104442131-104442153 CATCCTGGAAAGCCAGGAGCAGG + Intergenic
1124394348 15:29288374-29288396 GATGATGGGGAAACAGGAGCAGG - Intronic
1124848055 15:33310894-33310916 GCTGAGGCTGAGCCAGGAGCTGG + Intergenic
1125200062 15:37095385-37095407 GGAGCTGGCGAGCGAGGAGCAGG - Intronic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1125647641 15:41285541-41285563 GGTGCTTCTGAGCCAGGAGATGG + Intergenic
1125686037 15:41564001-41564023 GAGTCTGGTGAGCCTGGAGAGGG - Intronic
1125833292 15:42730888-42730910 GATTCTGGTGAGGAGGGAGCAGG - Intronic
1126369618 15:47932369-47932391 GATGCTGGAAAGGCAGGATCAGG + Intergenic
1127147150 15:56036018-56036040 CCTACTGGTGAGGCAGGAGCAGG - Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127893542 15:63275863-63275885 GATGCTGTGGAGACAGGAGGAGG - Intergenic
1128114713 15:65097941-65097963 GATGGTGGTGGGGCAGGAACGGG + Intronic
1128509856 15:68306726-68306748 GATGCTGGAGAGCAAAGAGGCGG - Intronic
1128764148 15:70240832-70240854 GATGGAGGTGAGGCAGGAGTGGG + Intergenic
1128792752 15:70445100-70445122 GATGCTGGCCATCCTGGAGCTGG - Intergenic
1128825350 15:70710783-70710805 GAGGATGGTGAACCAGGAGAGGG - Intronic
1128849483 15:70938517-70938539 GATGCTTGTGGTCCAGGAGGTGG + Intronic
1129206723 15:74041602-74041624 AAAGCTGATGAGCCTGGAGCAGG + Intronic
1129774191 15:78223938-78223960 AATGCTGGAGCACCAGGAGCTGG + Intronic
1129868691 15:78927539-78927561 GATGGTGGCGAGGCAGGAGATGG - Intronic
1130707415 15:86246346-86246368 GTTGCTGGGGAGCCTGGAGGTGG + Intronic
1131239286 15:90724733-90724755 GAGGCTGGTGTGCCTGGAGAGGG - Intronic
1131256503 15:90866202-90866224 GAGGCGGGTGAGCAAGGAGAGGG - Intergenic
1131332262 15:91512704-91512726 GATGCTGGTGATTAAAGAGCTGG + Intergenic
1132089931 15:98939952-98939974 TAGGCTGGTGAGCTAAGAGCAGG - Intronic
1132723570 16:1328675-1328697 GACAGTGGTGAGTCAGGAGCAGG - Intergenic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1133221805 16:4322097-4322119 GATGGTGGTGAGGGAGGAGCTGG + Intronic
1133510803 16:6455310-6455332 AAAGCTGGTGAGACAGAAGCAGG + Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134502057 16:14776962-14776984 GATGGCTGAGAGCCAGGAGCCGG + Intronic
1134578504 16:15351931-15351953 GATGGCTGAGAGCCAGGAGCCGG - Intergenic
1134724084 16:16405613-16405635 GATGGCTGAGAGCCAGGAGCCGG + Intergenic
1134943345 16:18306256-18306278 GATGGCTGAGAGCCAGGAGCCGG - Intergenic
1136104919 16:28023549-28023571 AATGCTGGTGGGACAGGAACTGG - Intronic
1136673551 16:31878706-31878728 GGTGCTATTGAGCCATGAGCAGG - Intronic
1139654745 16:68380549-68380571 GGCGCTGGTCAGCCGGGAGCAGG - Intronic
1141531550 16:84649562-84649584 GATGCTGGAGAGCCCAGAGAGGG - Intronic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142623844 17:1180223-1180245 GATCCTGCTGAGCCCGGCGCGGG - Intronic
1143021093 17:3917551-3917573 CTTGCTGGCGAGCCATGAGCTGG + Intergenic
1143160232 17:4864913-4864935 GAGGCTGGGGAGCCAGGAAAAGG - Intronic
1144422091 17:15107999-15108021 GATGCTGTTGGGTCAGAAGCAGG + Intergenic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1145777777 17:27541202-27541224 GGTGCTGGTGAGCTGGAAGCTGG + Intronic
1145895307 17:28454053-28454075 GAGGGTGGTGAGCCTGGAGACGG - Intergenic
1146626127 17:34436883-34436905 GAGGGTGCTGAGCCAGGAGGTGG - Intergenic
1146884140 17:36459689-36459711 GATGCTGGTGAGCGGCAAGCAGG - Intergenic
1147248226 17:39136166-39136188 GATCCTGCAGAGCAAGGAGCAGG - Intronic
1148105511 17:45116667-45116689 CATGCTGGTGACACAGGCGCTGG - Exonic
1148158658 17:45437567-45437589 GACGCTGGTGAGCCAGGGCCTGG + Exonic
1148454685 17:47804755-47804777 GATTCTTGGCAGCCAGGAGCTGG + Intergenic
1148860204 17:50600655-50600677 TCTGCTGAGGAGCCAGGAGCCGG + Intronic
1149758776 17:59210301-59210323 GATCCTGGGGATCCAGGACCTGG + Exonic
1150390079 17:64784966-64784988 GACGCTGGTGAGCCAGGGCCTGG + Intergenic
1151280437 17:73070205-73070227 GATACTGGTCAGCCTGCAGCTGG - Intronic
1151675751 17:75596534-75596556 GATGCTGCTGGCCCAGGAGGAGG + Intergenic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1152034461 17:77863639-77863661 GTTGCTGGTGAGCCCAGAGAGGG + Intergenic
1152073317 17:78144781-78144803 GATGGTGGGGAGGCAGGTGCAGG - Intergenic
1152186404 17:78859219-78859241 GAGGCAGCTGAGTCAGGAGCCGG - Intronic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152561172 17:81079524-81079546 GATGCTGGGGAGTGAGGAGGAGG - Intronic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152740299 17:82015777-82015799 GAAGCTGGGGAGCCAGGAAGGGG - Intronic
1152801475 17:82332803-82332825 GCTGCTGCTGAGCCCAGAGCGGG - Intronic
1154001038 18:10482555-10482577 GGTGGTGCTGAGCCAGGGGCCGG + Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1155152820 18:23135956-23135978 GATGTTGGTGAGGAAGGAGAGGG - Exonic
1155421861 18:25664908-25664930 GATTCTGGGAAGCCAGGAGAGGG - Intergenic
1157368978 18:47092678-47092700 CAAGCAGGTGAGCCTGGAGCTGG - Intronic
1158570839 18:58595890-58595912 GATGCTGGTGGTCCAAGACCAGG + Intronic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1161948785 19:7455576-7455598 GGTCCTGGTGACCCAGGAGCAGG + Intronic
1161964528 19:7540913-7540935 GATGCTGGTGACCCTGGGGGAGG - Exonic
1162385658 19:10359195-10359217 GATGGTGGTGGCCCAGCAGCTGG - Exonic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162793273 19:13073902-13073924 GATGCTGTTGCAACAGGAGCTGG - Exonic
1163006746 19:14401657-14401679 GACCCTGATGATCCAGGAGCGGG + Exonic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1163943965 19:20519052-20519074 GGAGCTGCTGAGCCAGGAGAAGG + Intergenic
1164443909 19:28300928-28300950 GATGCTGCTCAGGCAGGAGCAGG - Intergenic
1165486859 19:36101602-36101624 CATTCTGGTGAGCCAGGGCCAGG - Intronic
1165530822 19:36399334-36399356 GAAGCTGCTGAGCAAGAAGCAGG + Intronic
1165954483 19:39493593-39493615 GGTGCTTCTGAGCCAGGAGAAGG - Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166523694 19:43497849-43497871 GAGGCGGCTGAGCCAGGAACGGG - Exonic
1166541833 19:43610847-43610869 GATGCTGGGGACCCAGCAGGAGG - Intronic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166966770 19:46533744-46533766 GATCCTGGAGGGCCTGGAGCAGG + Intronic
1167151729 19:47713900-47713922 GGAGCTGGTGAGGCAGGAGAGGG - Intronic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
925404602 2:3597808-3597830 ACTGCTGCTGAGGCAGGAGCCGG + Intronic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
926171246 2:10553943-10553965 GATGCTAGTCAGCCATGGGCAGG + Intergenic
926709815 2:15869946-15869968 GATGCAGGTAAGCCGGGAGATGG - Intergenic
927506521 2:23618612-23618634 CAAGCTGGAGACCCAGGAGCGGG - Intronic
927720040 2:25376676-25376698 GATGCTGGGGAGCCAGCTGTGGG + Intergenic
929912130 2:46099106-46099128 CATTCTGGTAAGCAAGGAGCTGG + Intronic
930063246 2:47308469-47308491 GAAGCTCATGAGTCAGGAGCTGG - Intergenic
932312441 2:70754580-70754602 GAAGATGGTTAGCCAGGAGCTGG - Intronic
932426230 2:71637222-71637244 GATGTTGGTGACACAGGAGAGGG + Intronic
932492590 2:72131580-72131602 GATGCTGGGGAGACAGGGCCTGG + Exonic
932781298 2:74560267-74560289 CATGCTGGACAGCCTGGAGCTGG - Exonic
933892682 2:86786079-86786101 CATGCTGGTGCCCCAGGAACAGG - Intronic
934946665 2:98547394-98547416 GATGCTGGGGTGCATGGAGCAGG + Intronic
935234125 2:101123866-101123888 TATGCTGATGTGCCAGGAGGGGG - Intronic
935280517 2:101513426-101513448 GATGCTTGTAGACCAGGAGCTGG + Intergenic
935433424 2:103002740-103002762 CTTGCTGGTGTCCCAGGAGCAGG - Intergenic
937178285 2:119965042-119965064 GATGGTGGAGAGCAAGGGGCTGG + Intronic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
939866093 2:147474142-147474164 AATGCTGGTGAGGCAGGAAACGG + Intergenic
940209088 2:151237833-151237855 GGTGCTGGTGAGTCAGGGGCTGG - Intergenic
940847031 2:158652708-158652730 GATGCAGAATAGCCAGGAGCTGG + Intronic
941872299 2:170398696-170398718 GATGCTTTTGTGCCAGGAACTGG + Intronic
943450638 2:188038888-188038910 GAGCCAGGTGAGCCAGGAGAAGG - Intergenic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
946241661 2:218359666-218359688 GATGGGGGTGGGCCAGGTGCAGG - Intronic
946403765 2:219482427-219482449 GGAGCTGGGGAGCCAGGACCCGG + Intronic
947135508 2:226973347-226973369 GATGCTGGTGACCAAGAAGTGGG + Intronic
947170902 2:227310353-227310375 GATTGTAGTGAGCCAGGAGGTGG - Intronic
947913963 2:233819985-233820007 GGTGGTGGTGCGCCAGCAGCAGG - Exonic
948346268 2:237301229-237301251 GATGTTGGTGAGGCAGGAGTTGG + Intergenic
948826952 2:240577492-240577514 GAAGCTGGGAAGCCAGGGGCAGG + Intronic
1168833242 20:859009-859031 GATAGTGGGTAGCCAGGAGCTGG - Intergenic
1169812942 20:9627389-9627411 GATGCTGCTGACCCATGAGGCGG + Intronic
1171026267 20:21633116-21633138 GAGGCTGCTGAGACAGAAGCAGG + Intergenic
1171235507 20:23521087-23521109 GGTTCTGAAGAGCCAGGAGCAGG + Intergenic
1171449175 20:25224204-25224226 GATGCTCGTGACGCAGGCGCTGG + Intronic
1172484004 20:35287726-35287748 GATGCTGCTGAGGCTGGTGCTGG + Exonic
1173210772 20:41029565-41029587 GGGGCCGGTGAGCGAGGAGCCGG - Intronic
1173981055 20:47224518-47224540 GATGCGGCAGAGCCTGGAGCAGG - Exonic
1174097533 20:48101250-48101272 GGTGCTGCAGAGCCAGGATCAGG + Intergenic
1174203325 20:48822201-48822223 GATGCCGGAGAGCCTGGAACAGG - Intronic
1175893781 20:62327155-62327177 GAGGGTTGGGAGCCAGGAGCGGG - Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175916847 20:62430033-62430055 AATCCTGATCAGCCAGGAGCTGG + Intergenic
1176520660 21:7821759-7821781 CATGCAGGTGAGCCTGGAGCAGG - Intronic
1178610572 21:34075046-34075068 TATGCTGGTAAGCAAGGAGGAGG - Intronic
1178654683 21:34451771-34451793 CATGCAGGTGAGCCTGGAGCAGG - Intergenic
1178889568 21:36509882-36509904 AATGCTGCTGGGCCAGGCGCGGG - Intronic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180228289 21:46411482-46411504 GCTCCTGGTCAGCCAGCAGCCGG - Exonic
1180707136 22:17816920-17816942 CATCCTGGGGAGCCAGGAGCTGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181824988 22:25507753-25507775 GCTGAAGGTGAGCCAGGAGGAGG + Intergenic
1183352204 22:37340591-37340613 AATGATGGAGAGCCAGGAGGCGG + Intergenic
1183540792 22:38428256-38428278 GAAGCAGGTGAGCCTGGACCAGG + Intronic
1184137929 22:42560386-42560408 GATGAGGGTGAGGCAGGAGGGGG - Intronic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185389397 22:50550571-50550593 GAGGGTGGTGAGCCCGGAGTGGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950657944 3:14448943-14448965 GAAGGTTGTGAGCCAGGGGCAGG + Intronic
950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG + Intronic
952315612 3:32229713-32229735 GAGGCTGGTGGGGAAGGAGCAGG - Intergenic
952330747 3:32362495-32362517 GATGCTTGAGAGCCAGGAATGGG + Intronic
952858928 3:37796016-37796038 TATGCTGGAGAGACAGGAGCTGG - Intronic
953822937 3:46223942-46223964 GATCAGGGTGTGCCAGGAGCTGG + Intronic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954144519 3:48627930-48627952 GATGATGGTGAGACTGGAGGTGG - Exonic
956695658 3:71917087-71917109 GTAGCTGGTGAGCCAGGATGGGG + Intergenic
958421663 3:93938201-93938223 GGAGCTGCTGAGCCAGGAGAAGG - Intronic
959863251 3:111239163-111239185 TATGATGGTGAGCCAAGAACAGG - Intronic
964680438 3:159331968-159331990 TATGGTGATGAGCCAGGACCAGG - Intronic
966681141 3:182643368-182643390 GATGGTGGGGAGACAGGAGAGGG - Intergenic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
968472407 4:788148-788170 GGGGCTGCTGAGACAGGAGCAGG - Intronic
968725765 4:2247188-2247210 GATGCTGTGGCGCCTGGAGCTGG - Intergenic
968761548 4:2444855-2444877 CATGCTGGTGAGTGGGGAGCTGG - Intronic
969675382 4:8611535-8611557 GGTGCTGGTCAGCCTGGAGGTGG + Intronic
971150133 4:24022600-24022622 GGTGAAGGTGAGACAGGAGCAGG + Intergenic
972390817 4:38611178-38611200 GATGGTGGTGTGCCAGGGGTGGG + Intergenic
978249185 4:106610274-106610296 GATCTTGGGGAGCCAGGAACAGG + Intergenic
984412249 4:179409050-179409072 GGAGCTCGTGAGCCAGGAGAAGG - Intergenic
985105367 4:186494045-186494067 GCTACCAGTGAGCCAGGAGCAGG + Intronic
985706702 5:1405731-1405753 GATGCTGCTGAGCCAGAGGGAGG + Intronic
986238847 5:5938679-5938701 GAAGGGGGTGAGCCAGGGGCTGG + Intergenic
986725528 5:10593752-10593774 GATCCAGGTGAGCCAGGGTCAGG - Intronic
987955491 5:24734282-24734304 GATGATGGTGAGGCTGAAGCAGG + Intergenic
991407981 5:66320271-66320293 GAGGCTGTGGAGCCAGGACCAGG - Intergenic
994115670 5:96059172-96059194 GATGCTAGGTAGCCAGGAGGTGG - Intergenic
994326221 5:98448614-98448636 GATGCAGGTGGGCGTGGAGCTGG - Intergenic
994631811 5:102296367-102296389 GAGGCTGGAGGGCCAGGAGGCGG - Exonic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
997389246 5:133500149-133500171 GAGGATGGTGAGCCAGGCCCAGG - Intronic
997853085 5:137350112-137350134 GATGCTTGAGAGTCAGGTGCTGG + Intronic
998138555 5:139687359-139687381 GGTGATTGTGGGCCAGGAGCTGG + Intergenic
998535805 5:142929825-142929847 TTTGCTGGTGAGCCACTAGCAGG + Intronic
998629244 5:143880258-143880280 GAAGCTGGAGAGACTGGAGCAGG + Intergenic
1000549669 5:162644772-162644794 GATGCTGATGAGCAAGTACCTGG + Intergenic
1000776165 5:165422865-165422887 GATGCTGGTGGTCCATGTGCTGG + Intergenic
1001628711 5:173158577-173158599 GTTGCTGGGGAACCAGGAGGCGG + Intronic
1001652718 5:173327363-173327385 CTTGCCGGTGAGCCAAGAGCCGG + Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002336580 5:178483471-178483493 GGTGCTGGAAAGCCAGGAGAAGG - Intronic
1002427481 5:179184870-179184892 GAGGCCGGTGATCCTGGAGCTGG - Intronic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007244427 6:40450328-40450350 GACTCTGATGGGCCAGGAGCTGG - Intronic
1008698903 6:54075182-54075204 GATTGTGGTGAGCCAAGATCAGG + Intronic
1010952905 6:82058127-82058149 GATGCAGATGAGTAAGGAGCAGG + Intergenic
1015862930 6:137699425-137699447 GGGGTTGGTGAGCCATGAGCCGG - Intergenic
1016518450 6:144923364-144923386 GAAGCTTCTGAGCCAGGAGAAGG - Intergenic
1016649848 6:146450690-146450712 GAAGCTTCTGAGCCAGGAGAAGG + Intergenic
1016650723 6:146456258-146456280 GAAGCTTCTGAGCCAGGAGAAGG + Intergenic
1016914078 6:149228498-149228520 CAGGCTGGGGAGCCAGGAGATGG - Intronic
1017722124 6:157250912-157250934 GATGCTGATGAGTCGGGGGCCGG + Intergenic
1017908356 6:158772096-158772118 GTAGCTGGTGTGGCAGGAGCAGG - Intronic
1018893444 6:167997606-167997628 GGTGCTGGTGAGGAAGGGGCAGG - Intronic
1019062109 6:169263892-169263914 CATGCTGGTGGGCAAGAAGCCGG - Intergenic
1019135976 6:169907922-169907944 GAGGCTGGGGAGACGGGAGCAGG + Intergenic
1019294670 7:267389-267411 GGTCCTGGGGAGGCAGGAGCAGG - Intergenic
1019417243 7:933474-933496 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417254 7:933504-933526 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417270 7:933541-933563 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417301 7:933631-933653 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417312 7:933661-933683 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417323 7:933691-933713 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417354 7:933781-933803 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417395 7:933901-933923 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417416 7:933961-933983 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417427 7:933991-934013 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417466 7:934111-934133 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417487 7:934171-934193 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417498 7:934201-934223 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417536 7:934321-934343 GGTGCTGGAGAACCAGGGGCTGG + Intronic
1019772186 7:2890628-2890650 GATGCAGGAGATTCAGGAGCGGG + Intergenic
1019989787 7:4683039-4683061 GATCCTAGGGAGCCAGGAGGCGG - Intronic
1020273462 7:6610977-6610999 AAAGCTGGTGGGCCAGTAGCAGG - Intergenic
1022504881 7:30903679-30903701 GAGGCTGGGGAGCTGGGAGCTGG + Intergenic
1022877814 7:34552967-34552989 CATGCTGGTGACCCTGGTGCAGG - Intergenic
1023291052 7:38669478-38669500 GAGGGTGGTCAGCCAGGAGTAGG + Intergenic
1024762706 7:52619371-52619393 GATCCTGGGGAGCCTGAAGCCGG + Intergenic
1026530187 7:71190430-71190452 GATGAAGGTGAAGCAGGAGCAGG - Intronic
1026848129 7:73708932-73708954 GGAGCTGCTGAGCCAGGTGCAGG + Intronic
1026904145 7:74053240-74053262 GGTGTTGGTGTCCCAGGAGCTGG + Exonic
1026989508 7:74575737-74575759 GAAGCTGGTGGGGCAGGAGGTGG + Intronic
1027694159 7:81387983-81388005 GATACTGGAGAGCCAGTATCTGG - Intergenic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1029921432 7:104268807-104268829 GATGAGGGTGAGAGAGGAGCAGG - Intergenic
1030529244 7:110692325-110692347 GATGCTGGAGACTCAGGAGGGGG + Intronic
1032394757 7:131581466-131581488 GAAACGGGTGGGCCAGGAGCCGG - Intergenic
1032439344 7:131930267-131930289 CATACAGGTGAGCAAGGAGCAGG - Intergenic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1033356883 7:140607367-140607389 GAGGCTGGGGAACCATGAGCTGG + Intronic
1034306894 7:150050641-150050663 GATGCAGGTGTGAAAGGAGCCGG + Intergenic
1034799957 7:154050046-154050068 GATGCAGGTGTGAAAGGAGCCGG - Intronic
1034937985 7:155211995-155212017 GAGGCTGGTGCTGCAGGAGCTGG - Intergenic
1035081403 7:156219444-156219466 GATGCTGGGGAGGAAGCAGCAGG - Intergenic
1036082662 8:5574454-5574476 GATGCTGGTGTGAAAAGAGCAGG - Intergenic
1037355359 8:18013526-18013548 GATGATGTTGGGGCAGGAGCTGG - Intronic
1037940025 8:22944301-22944323 GAGGCTGGTGGACAAGGAGCAGG + Intronic
1038450276 8:27634798-27634820 CAGGGTGGTGAGCCAGCAGCAGG + Intronic
1040593592 8:48818031-48818053 GAGGCTGGTGAGGAAGAAGCTGG - Intergenic
1040638064 8:49299071-49299093 TATGGTGGTGAGCTGGGAGCTGG + Intergenic
1041659969 8:60391952-60391974 GAGGCTGGTGAGGCTGGAGGAGG - Intergenic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1045325724 8:101116367-101116389 GACCCTGGACAGCCAGGAGCAGG + Intergenic
1048342730 8:133553330-133553352 AAGGCTGGTGAAACAGGAGCTGG - Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049456418 8:142693310-142693332 TCTGCTGGGGAGCCTGGAGCCGG - Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049747663 8:144269847-144269869 GGCGCTGGTGAGTGAGGAGCAGG + Intronic
1050091200 9:2017201-2017223 GATGGTGGTGAGCGCGGGGCTGG + Intronic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1050258796 9:3819525-3819547 GATGTTGGTGTGGCAGGAGAAGG - Intergenic
1052569060 9:30198246-30198268 GATGGAGGGGAGCCAGGAACGGG + Intergenic
1053069382 9:35092122-35092144 GAAGCTGGACAACCAGGAGCAGG + Exonic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1053576822 9:39362662-39362684 AAGGCCGGTGACCCAGGAGCAGG - Intergenic
1053841335 9:42190587-42190609 AAGGCCGGTGACCCAGGAGCAGG - Intergenic
1054098392 9:60921353-60921375 AAGGCCGGTGACCCAGGAGCAGG - Intergenic
1054119793 9:61196983-61197005 AAGGCCGGTGACCCAGGAGCAGG - Intergenic
1054587961 9:66985579-66985601 AAGGCCGGTGACCCAGGAGCAGG + Intergenic
1054942035 9:70753926-70753948 GAAGGTGGTGAACTAGGAGCAGG + Intronic
1055679273 9:78698202-78698224 GATGCTACTGATTCAGGAGCAGG + Intergenic
1055712523 9:79079081-79079103 GAGACTGGTTAGCCAGGAGGGGG + Intergenic
1057397273 9:94691295-94691317 CATGCTGCAGAGGCAGGAGCAGG - Intergenic
1057776851 9:98018364-98018386 GGTGGTGGTGATACAGGAGCGGG - Intergenic
1057868292 9:98698926-98698948 GAAGCTTCTGACCCAGGAGCAGG + Intronic
1058315017 9:103554374-103554396 GATGCTGGTGAGGATGGTGCTGG - Intergenic
1058551815 9:106122954-106122976 GAGGTTGGTGAGCCTGGAGAGGG + Intergenic
1059504755 9:114788316-114788338 GACTCTGGTGAGCCAGGTGGAGG + Exonic
1059944422 9:119394391-119394413 GATGCTATTGAGCCAGGACAGGG + Intergenic
1060234579 9:121853432-121853454 GGTGGTGGTGAGCAAGGAGAGGG + Intronic
1060696209 9:125711144-125711166 GATGGTGCTGGGCCAGGGGCTGG + Intergenic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061410346 9:130417655-130417677 AATGCTGGTGGGGCAGAAGCTGG + Intronic
1061801124 9:133113940-133113962 GATGGTGCTCAGCCAGGACCTGG - Intronic
1061912507 9:133732521-133732543 GCGGGTGGTGAGCCGGGAGCTGG - Exonic
1062044601 9:134419171-134419193 GAGGCTGGTGAGGCGGGAGCAGG - Intronic
1062259769 9:135655730-135655752 GAGGCCAGTGAGCCAGGGGCGGG - Intergenic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1185487652 X:495200-495222 GATGCCGGAGAGCTGGGAGCTGG + Intergenic
1186507929 X:10109054-10109076 GATGCTGGTGAGAGATGATCTGG - Intronic
1190728473 X:53208264-53208286 GAAGATGATGAGCCACGAGCAGG + Intronic
1193420848 X:81280347-81280369 TATGCTGGTTGGCCAGGAGGTGG - Intronic
1194919713 X:99749993-99750015 GAAGCTTCTGAGCCAGGAGAAGG + Intergenic
1195023821 X:100855636-100855658 GATGGTGGTTATCCAGGAGGCGG - Intronic
1197612316 X:128653223-128653245 GATGCTCATGAGCAAGGTGCTGG - Intergenic
1197793732 X:130279950-130279972 GGTGCTTCTGAGCCAGGAGAAGG - Intergenic
1199609501 X:149600750-149600772 GAGGCTGCGGAGCCAGGTGCAGG - Intronic
1199629615 X:149768604-149768626 GAGGCTGCGGAGCCAGGTGCAGG + Intergenic
1199680292 X:150219812-150219834 GATGCTCCTGAGCCAGGAGATGG - Intergenic
1199996425 X:153029364-153029386 GGTGCAGGTGAGGGAGGAGCTGG + Intergenic
1202058203 Y:20857844-20857866 GAACCTGCTGAGCCAGGTGCGGG + Intergenic