ID: 944406729

View in Genome Browser
Species Human (GRCh38)
Location 2:199393118-199393140
Sequence CATTTGTAGCAGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944406729_944406737 11 Left 944406729 2:199393118-199393140 CCACCCACCCTCTGCTACAAATG No data
Right 944406737 2:199393152-199393174 CCTCTGCACTTAAAAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944406729 Original CRISPR CATTTGTAGCAGAGGGTGGG TGG (reversed) Intronic
No off target data available for this crispr