ID: 944410538

View in Genome Browser
Species Human (GRCh38)
Location 2:199437809-199437831
Sequence TAGGCCTTGAAAAAAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944410538_944410540 3 Left 944410538 2:199437809-199437831 CCAGTAATTTTTTTCAAGGCCTA No data
Right 944410540 2:199437835-199437857 TCAATGTTCACGATACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944410538 Original CRISPR TAGGCCTTGAAAAAAATTAC TGG (reversed) Intronic
No off target data available for this crispr