ID: 944410540

View in Genome Browser
Species Human (GRCh38)
Location 2:199437835-199437857
Sequence TCAATGTTCACGATACTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944410538_944410540 3 Left 944410538 2:199437809-199437831 CCAGTAATTTTTTTCAAGGCCTA No data
Right 944410540 2:199437835-199437857 TCAATGTTCACGATACTAAAAGG No data
944410536_944410540 28 Left 944410536 2:199437784-199437806 CCATTTTACAGAGGAAAAAAATT No data
Right 944410540 2:199437835-199437857 TCAATGTTCACGATACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944410540 Original CRISPR TCAATGTTCACGATACTAAA AGG Intronic
No off target data available for this crispr