ID: 944413553

View in Genome Browser
Species Human (GRCh38)
Location 2:199463398-199463420
Sequence CGACCCGCCGCGTTTTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944413540_944413553 19 Left 944413540 2:199463356-199463378 CCAGCTCGGAGCTGCCGGGGTTG No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413536_944413553 22 Left 944413536 2:199463353-199463375 CCCCCAGCTCGGAGCTGCCGGGG No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413539_944413553 20 Left 944413539 2:199463355-199463377 CCCAGCTCGGAGCTGCCGGGGTT No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413532_944413553 26 Left 944413532 2:199463349-199463371 CCCGCCCCCAGCTCGGAGCTGCC No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413548_944413553 -7 Left 944413548 2:199463382-199463404 CCCCGGGTGGCGCTCCCGACCCG No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413531_944413553 27 Left 944413531 2:199463348-199463370 CCCCGCCCCCAGCTCGGAGCTGC No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413547_944413553 5 Left 944413547 2:199463370-199463392 CCGGGGTTGGGGCCCCGGGTGGC No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413549_944413553 -8 Left 944413549 2:199463383-199463405 CCCGGGTGGCGCTCCCGACCCGC No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413538_944413553 21 Left 944413538 2:199463354-199463376 CCCCAGCTCGGAGCTGCCGGGGT No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413533_944413553 25 Left 944413533 2:199463350-199463372 CCGCCCCCAGCTCGGAGCTGCCG No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data
944413550_944413553 -9 Left 944413550 2:199463384-199463406 CCGGGTGGCGCTCCCGACCCGCC No data
Right 944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944413553 Original CRISPR CGACCCGCCGCGTTTTCCTT AGG Intronic
No off target data available for this crispr