ID: 944413616

View in Genome Browser
Species Human (GRCh38)
Location 2:199463633-199463655
Sequence TGGACTGCAGGCGACGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944413616_944413629 4 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413629 2:199463660-199463682 TTAAGGATGTGGCGGGGGATGGG No data
944413616_944413632 21 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413632 2:199463677-199463699 GATGGGCAGGTCCCTGGCCCAGG No data
944413616_944413625 -3 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413625 2:199463653-199463675 CCACGGGTTAAGGATGTGGCGGG No data
944413616_944413628 3 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413628 2:199463659-199463681 GTTAAGGATGTGGCGGGGGATGG No data
944413616_944413630 8 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413630 2:199463664-199463686 GGATGTGGCGGGGGATGGGCAGG No data
944413616_944413626 -2 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413626 2:199463654-199463676 CACGGGTTAAGGATGTGGCGGGG No data
944413616_944413631 15 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413631 2:199463671-199463693 GCGGGGGATGGGCAGGTCCCTGG No data
944413616_944413633 22 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413633 2:199463678-199463700 ATGGGCAGGTCCCTGGCCCAGGG No data
944413616_944413627 -1 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413627 2:199463655-199463677 ACGGGTTAAGGATGTGGCGGGGG No data
944413616_944413622 -7 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413622 2:199463649-199463671 CAGTCCACGGGTTAAGGATGTGG No data
944413616_944413623 -4 Left 944413616 2:199463633-199463655 CCTTCCGCGTCGCCTGCAGTCCA No data
Right 944413623 2:199463652-199463674 TCCACGGGTTAAGGATGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944413616 Original CRISPR TGGACTGCAGGCGACGCGGA AGG (reversed) Intronic