ID: 944418794

View in Genome Browser
Species Human (GRCh38)
Location 2:199506362-199506384
Sequence TTTTAAACACAGTTGTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944418794_944418798 9 Left 944418794 2:199506362-199506384 CCATGTTACAACTGTGTTTAAAA No data
Right 944418798 2:199506394-199506416 AACTAACCCTACTGTGGGCAGGG No data
944418794_944418797 8 Left 944418794 2:199506362-199506384 CCATGTTACAACTGTGTTTAAAA No data
Right 944418797 2:199506393-199506415 AAACTAACCCTACTGTGGGCAGG No data
944418794_944418802 19 Left 944418794 2:199506362-199506384 CCATGTTACAACTGTGTTTAAAA No data
Right 944418802 2:199506404-199506426 ACTGTGGGCAGGGCTCTTGGTGG No data
944418794_944418803 20 Left 944418794 2:199506362-199506384 CCATGTTACAACTGTGTTTAAAA No data
Right 944418803 2:199506405-199506427 CTGTGGGCAGGGCTCTTGGTGGG No data
944418794_944418795 3 Left 944418794 2:199506362-199506384 CCATGTTACAACTGTGTTTAAAA No data
Right 944418795 2:199506388-199506410 ATTTTAAACTAACCCTACTGTGG No data
944418794_944418801 16 Left 944418794 2:199506362-199506384 CCATGTTACAACTGTGTTTAAAA No data
Right 944418801 2:199506401-199506423 CCTACTGTGGGCAGGGCTCTTGG No data
944418794_944418796 4 Left 944418794 2:199506362-199506384 CCATGTTACAACTGTGTTTAAAA No data
Right 944418796 2:199506389-199506411 TTTTAAACTAACCCTACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944418794 Original CRISPR TTTTAAACACAGTTGTAACA TGG (reversed) Intergenic
No off target data available for this crispr