ID: 944427230

View in Genome Browser
Species Human (GRCh38)
Location 2:199595851-199595873
Sequence TCATCTCTGTTTTACAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944427230_944427231 -1 Left 944427230 2:199595851-199595873 CCTCATCTGTAAAACAGAGATGA No data
Right 944427231 2:199595873-199595895 ACAATAATAAAACAACCTTTAGG No data
944427230_944427232 4 Left 944427230 2:199595851-199595873 CCTCATCTGTAAAACAGAGATGA No data
Right 944427232 2:199595878-199595900 AATAAAACAACCTTTAGGAGTGG No data
944427230_944427234 27 Left 944427230 2:199595851-199595873 CCTCATCTGTAAAACAGAGATGA No data
Right 944427234 2:199595901-199595923 CAGCGAAGTGAAGTGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944427230 Original CRISPR TCATCTCTGTTTTACAGATG AGG (reversed) Intergenic