ID: 944427231

View in Genome Browser
Species Human (GRCh38)
Location 2:199595873-199595895
Sequence ACAATAATAAAACAACCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944427229_944427231 8 Left 944427229 2:199595842-199595864 CCTCAGTTTCCTCATCTGTAAAA No data
Right 944427231 2:199595873-199595895 ACAATAATAAAACAACCTTTAGG No data
944427230_944427231 -1 Left 944427230 2:199595851-199595873 CCTCATCTGTAAAACAGAGATGA No data
Right 944427231 2:199595873-199595895 ACAATAATAAAACAACCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944427231 Original CRISPR ACAATAATAAAACAACCTTT AGG Intergenic