ID: 944427232

View in Genome Browser
Species Human (GRCh38)
Location 2:199595878-199595900
Sequence AATAAAACAACCTTTAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944427230_944427232 4 Left 944427230 2:199595851-199595873 CCTCATCTGTAAAACAGAGATGA No data
Right 944427232 2:199595878-199595900 AATAAAACAACCTTTAGGAGTGG No data
944427229_944427232 13 Left 944427229 2:199595842-199595864 CCTCAGTTTCCTCATCTGTAAAA No data
Right 944427232 2:199595878-199595900 AATAAAACAACCTTTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944427232 Original CRISPR AATAAAACAACCTTTAGGAG TGG Intergenic