ID: 944427233

View in Genome Browser
Species Human (GRCh38)
Location 2:199595888-199595910
Sequence CACTTCGCTGCCACTCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944427233_944427234 -10 Left 944427233 2:199595888-199595910 CCTTTAGGAGTGGCAGCGAAGTG No data
Right 944427234 2:199595901-199595923 CAGCGAAGTGAAGTGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944427233 Original CRISPR CACTTCGCTGCCACTCCTAA AGG (reversed) Intergenic