ID: 944427234

View in Genome Browser
Species Human (GRCh38)
Location 2:199595901-199595923
Sequence CAGCGAAGTGAAGTGAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944427230_944427234 27 Left 944427230 2:199595851-199595873 CCTCATCTGTAAAACAGAGATGA No data
Right 944427234 2:199595901-199595923 CAGCGAAGTGAAGTGAACCAAGG No data
944427233_944427234 -10 Left 944427233 2:199595888-199595910 CCTTTAGGAGTGGCAGCGAAGTG No data
Right 944427234 2:199595901-199595923 CAGCGAAGTGAAGTGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944427234 Original CRISPR CAGCGAAGTGAAGTGAACCA AGG Intergenic