ID: 944427234 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:199595901-199595923 |
| Sequence | CAGCGAAGTGAAGTGAACCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 944427230_944427234 | 27 | Left | 944427230 | 2:199595851-199595873 | CCTCATCTGTAAAACAGAGATGA | 0: 3 1: 41 2: 332 3: 1370 4: 4363 |
||
| Right | 944427234 | 2:199595901-199595923 | CAGCGAAGTGAAGTGAACCAAGG | No data | ||||
| 944427233_944427234 | -10 | Left | 944427233 | 2:199595888-199595910 | CCTTTAGGAGTGGCAGCGAAGTG | No data | ||
| Right | 944427234 | 2:199595901-199595923 | CAGCGAAGTGAAGTGAACCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 944427234 | Original CRISPR | CAGCGAAGTGAAGTGAACCA AGG | Intergenic | ||