ID: 944432387

View in Genome Browser
Species Human (GRCh38)
Location 2:199647137-199647159
Sequence AGGTACCACCTGGACATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944432376_944432387 29 Left 944432376 2:199647085-199647107 CCAGGGGCTGGCTCCCTTGCCCT 0: 1
1: 0
2: 1
3: 52
4: 369
Right 944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 104
944432380_944432387 15 Left 944432380 2:199647099-199647121 CCTTGCCCTCTGGCTTCTGGTTG No data
Right 944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 104
944432375_944432387 30 Left 944432375 2:199647084-199647106 CCCAGGGGCTGGCTCCCTTGCCC 0: 1
1: 0
2: 1
3: 30
4: 296
Right 944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 104
944432383_944432387 9 Left 944432383 2:199647105-199647127 CCTCTGGCTTCTGGTTGGACTCA 0: 1
1: 4
2: 14
3: 65
4: 322
Right 944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 104
944432379_944432387 16 Left 944432379 2:199647098-199647120 CCCTTGCCCTCTGGCTTCTGGTT 0: 7
1: 26
2: 82
3: 195
4: 705
Right 944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 104
944432382_944432387 10 Left 944432382 2:199647104-199647126 CCCTCTGGCTTCTGGTTGGACTC 0: 1
1: 3
2: 9
3: 91
4: 316
Right 944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944432387 Original CRISPR AGGTACCACCTGGACATTGA AGG Intergenic
910862053 1:91751378-91751400 AGGTAACAGCTGGACATGCACGG + Intronic
918113659 1:181479598-181479620 AGGATCCTCCTGGATATTGAGGG + Intronic
920549726 1:206847991-206848013 AGGTACCACCTTGACAATCTTGG - Intergenic
922435059 1:225596784-225596806 AGGTACAACTTGGGCAGTGAAGG + Intronic
924609039 1:245558595-245558617 AGGTCCCTCCTGGACAAGGAAGG + Intronic
1067324576 10:45255283-45255305 AGATAACACCTGGACATTGTGGG + Intergenic
1067345159 10:45432936-45432958 AGGTAGCTCCTTTACATTGACGG + Intronic
1071349422 10:84724698-84724720 AGTTATCACCTCAACATTGAGGG + Intergenic
1071604952 10:86979583-86979605 AGGGACCCCCAGGACATTGAGGG + Intronic
1075326713 10:121538591-121538613 ACGTACCACCTGGATGTTGTGGG - Exonic
1075837617 10:125468952-125468974 AGTTACCCACTGGACATGGATGG - Intergenic
1076606694 10:131694247-131694269 AGGCACCACCTGGCCTTTGGAGG + Intergenic
1077350053 11:2088955-2088977 AGGGACCACCCAGACATGGAAGG + Intergenic
1078759833 11:14243112-14243134 AGGTATGTCCTGGACACTGAAGG - Intronic
1079701598 11:23555533-23555555 AGGTACCACCTTGACAGTCTTGG + Intergenic
1081354839 11:42099809-42099831 AGGTACCACCTGGGAGGTGAAGG + Intergenic
1083850579 11:65364037-65364059 AGGTGCCATCTGAACATAGAGGG - Intergenic
1084510428 11:69600245-69600267 ATGCACCAGATGGACATTGATGG - Intergenic
1089352160 11:117827997-117828019 AGGTACCACCTGTCCATGGCAGG + Intronic
1089533273 11:119145552-119145574 AGGATCCACCTGGACGTTGAGGG + Intergenic
1094469304 12:30788720-30788742 AGGTACCACCTGGAGGGGGAAGG + Intergenic
1094682786 12:32680401-32680423 ATGTACCTCCTGGAAAATGATGG - Intronic
1096109012 12:49018313-49018335 AGGTAGCTCCTGGACCTCGATGG - Intronic
1101886190 12:108664984-108665006 GGGTGCCATCTGGAGATTGAAGG - Intronic
1105700732 13:22934495-22934517 AGGTGCCAGCTGGTCATTGAAGG - Intergenic
1105853559 13:24357568-24357590 AGGTGCCAGCTGGCCACTGAAGG - Intergenic
1105969197 13:25412768-25412790 AGGTCCTACCTGGACACTGTGGG - Intronic
1106220627 13:27743747-27743769 AGGGAGCACCAGGACAGTGACGG - Intergenic
1106698805 13:32207029-32207051 AGGTAGCTCCTGGACAGTCAAGG - Intronic
1109232739 13:59779106-59779128 AGGTTCCAGGTGGACAGTGATGG - Intronic
1115485709 14:33909386-33909408 AAGCACCACCTGGCCATTTACGG - Intergenic
1115524862 14:34269804-34269826 AGGTTCCACCTGGCCAATGATGG - Intronic
1118799334 14:69174866-69174888 AGATACCACCTGGCCATTTTGGG - Intergenic
1118843135 14:69527437-69527459 AGGTGCTCCCTGGATATTGAAGG + Intronic
1119484783 14:74980340-74980362 AGGTACCACCCAGACCTTGGAGG + Intergenic
1120186518 14:81399037-81399059 AGATACCATCTGGAGATTGTTGG - Intronic
1126312457 15:47333534-47333556 AAGTACCACCTAGAATTTGATGG + Intronic
1127152917 15:56096531-56096553 AGTGACCACCTGTACATTGAGGG + Exonic
1130558940 15:84943995-84944017 AGTTAGCACCTGGGCCTTGAAGG + Intronic
1131429706 15:92377074-92377096 AAGTAACACATGGACATTGTAGG + Intergenic
1131438070 15:92438771-92438793 AGGTACATTCTGGACATTGGAGG - Intronic
1131732627 15:95297888-95297910 AGGTACCATCTGTGCATTGTAGG - Intergenic
1131888540 15:96947303-96947325 AGCTCCCACCTGGGCATGGAGGG - Intergenic
1132101726 15:99028407-99028429 GGGTACCACCTGTAAATGGATGG + Intergenic
1134366759 16:13585969-13585991 AGAAACCACATGGACATTGGTGG - Intergenic
1138314421 16:56056641-56056663 AGGGGCCACCTGGACATGCAGGG - Intergenic
1144958076 17:19029646-19029668 AGGCTCCACCTGGGCCTTGAAGG - Intronic
1144977082 17:19144874-19144896 AGGCTCCACCTGGGCCTTGAAGG + Intronic
1150315927 17:64168836-64168858 AGGTAGCAGCTGTACACTGATGG + Intronic
1151603365 17:75120244-75120266 AGGGACAACCTGGACCATGAAGG - Intronic
1155926096 18:31657012-31657034 ATGTACCACTTTGATATTGATGG - Intronic
1162087325 19:8256627-8256649 AGGTACCACCAGTACAGGGATGG - Exonic
1165324174 19:35104573-35104595 GGGTGCCACCTGGACTGTGATGG - Intergenic
1166197928 19:41219106-41219128 AGGGGCCACCTGGACAATCAGGG - Intergenic
1167189993 19:47979890-47979912 AAGAACCAACTGGACATTGATGG - Intronic
1167523125 19:49968907-49968929 AATTACCACCTGGGCATAGAGGG - Intergenic
1167984965 19:53306970-53306992 AGATAGCACCTGGTTATTGAGGG + Intergenic
930480035 2:51936486-51936508 AGATACCACATGGCAATTGATGG + Intergenic
933694930 2:85210572-85210594 AGGTTTCACCAGGCCATTGAAGG + Intronic
934165089 2:89287051-89287073 AGGTACTGCCTGGCCATTCAGGG - Intergenic
934202184 2:89895411-89895433 AGGTACTGCCTGGCCATTCAGGG + Intergenic
940187665 2:151004703-151004725 TGGCAGCACCTGGACATTCATGG + Intronic
940899316 2:159111865-159111887 ATGTAACACTTGGATATTGAAGG + Intronic
944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG + Intergenic
1170362983 20:15567716-15567738 TGCTACCACCTGGACCTTGTAGG - Intronic
1172863583 20:38077258-38077280 AGTTACCAACTGGATGTTGATGG + Intronic
1173598340 20:44274785-44274807 AAATACCACCTCCACATTGATGG + Intronic
1175801342 20:61802735-61802757 AGGTGCCACCTGGGCCTAGACGG + Intronic
1177089091 21:16743642-16743664 AGGAACCATCTGGACATTCCAGG + Intergenic
1177438738 21:21090081-21090103 CGGCAGCAACTGGACATTGATGG + Intronic
949121856 3:394743-394765 AGGTGCCAGCTGGGCTTTGATGG - Exonic
950565373 3:13766832-13766854 AGGCAACACCTGGGCTTTGAGGG - Intergenic
950745099 3:15081775-15081797 AGGTCTCACCTGGCCATTAAGGG + Intronic
951608682 3:24466434-24466456 AACTACCACCTGGAGAGTGAAGG + Intronic
952924467 3:38310930-38310952 ATGTGCCACCTGGAGTTTGAGGG - Intronic
956724482 3:72145858-72145880 GGGTACCATCTGAATATTGAAGG - Intergenic
958952068 3:100427497-100427519 AGGTAGCCACTGGGCATTGAAGG + Intronic
962734823 3:138316542-138316564 AAATACCACCTGGACTGTGAAGG - Intronic
966602864 3:181793089-181793111 AGGTATCCCCAGGACATTTAAGG - Intergenic
967508110 3:190276982-190277004 AGTAACCAACTGGAAATTGAAGG - Intergenic
973824712 4:54693550-54693572 AGGTACAACCTGGCCAGTAATGG - Intronic
974342317 4:60630061-60630083 AGGGAGCACTTAGACATTGATGG - Intergenic
974635477 4:64558973-64558995 AGCTAGCAACTGGATATTGATGG + Intergenic
976908364 4:90267721-90267743 AGGTACCACCTTGACAGTTTGGG - Intronic
989176806 5:38535697-38535719 AGGTACTGCTTGGACACTGAGGG - Intronic
989382666 5:40824568-40824590 ATGTACTACCTGGAGATTTAAGG - Intergenic
989563067 5:42873192-42873214 AAGTACCAGCAGGAGATTGAAGG + Intronic
990149804 5:52803580-52803602 AGCTGCAACCTGGACACTGAGGG - Exonic
991100590 5:62788186-62788208 AGGTACCAGCTGGAGATTGGAGG + Intergenic
1001686244 5:173597009-173597031 AGGGTGCACCTGGACATTGGTGG - Intergenic
1002192182 5:177484049-177484071 AGGTACCCACTGGCCAGTGAGGG - Exonic
1004235910 6:13874038-13874060 GGCTTCCACCTGGACAGTGACGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1008258583 6:49336197-49336219 ACATACCACATGGACATTAAAGG + Intergenic
1013873426 6:114795817-114795839 AGCTATCACTTGGACTTTGAAGG - Intergenic
1018380654 6:163255370-163255392 AGTCACCTCCTGGACATTGAAGG - Intronic
1020722302 7:11762353-11762375 AGGAACCGCCTAGACATTGCTGG - Intronic
1021968567 7:25945858-25945880 AGGTGCCAGCTGGATATTGGAGG - Intergenic
1026248390 7:68644819-68644841 TGGAACCACGTGGACACTGAGGG + Intergenic
1033561818 7:142539166-142539188 AGACACCAGCTGGACATTGAAGG - Intergenic
1034362937 7:150517308-150517330 AGGTTCCAACTGGACAAAGATGG - Intronic
1035675302 8:1451728-1451750 AGGGAGCTCCTGGACATAGATGG - Intergenic
1037416796 8:18659952-18659974 AGTTACCACATGGACCTTAATGG + Intronic
1038767932 8:30447075-30447097 AGGCACCACCTGGAAGTTGCAGG + Intronic
1041859580 8:62497738-62497760 AGGTACCAACTGCACAGTGCAGG - Intronic
1047277669 8:123417788-123417810 AGGTACCTCCTGGACATCGATGG - Intronic
1052034010 9:23659804-23659826 AGGTACCACCTGGGCCCTGTTGG - Intergenic
1060378597 9:123142503-123142525 AGATACCACCTGGGCAGTGATGG - Intronic
1061611633 9:131750401-131750423 AGGGACCATCGGGACAATGATGG - Intergenic
1191201982 X:57793113-57793135 AAGTACCATCTGGACAATAAAGG + Intergenic
1192226488 X:69231703-69231725 ATGCACCACCTGGACATAGTAGG - Intergenic
1193041122 X:77004876-77004898 TGGTACCACCTGAAAATTTATGG + Intergenic
1194308031 X:92272797-92272819 AGGTAGCACTTTGACATTCAAGG + Intronic
1194889929 X:99365448-99365470 AGGTACCACCTTGACAATCTTGG - Intergenic
1195250107 X:103035406-103035428 AGGGAACACTTGGACATTGTTGG - Intergenic
1199032062 X:143012493-143012515 ATGTACCACCTGTAAACTGATGG - Intergenic
1199795597 X:151192301-151192323 AGGTGCCACCTGGACAGTGTTGG - Intergenic
1200213743 X:154358331-154358353 AGGCAGCACCTTGACCTTGAAGG + Exonic