ID: 944434533

View in Genome Browser
Species Human (GRCh38)
Location 2:199672868-199672890
Sequence TCTACCAAACAGAAGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944434533_944434540 15 Left 944434533 2:199672868-199672890 CCCACCCTCTTCTGTTTGGTAGA No data
Right 944434540 2:199672906-199672928 CTGACCCATGTTCAAAGGAAGGG No data
944434533_944434539 14 Left 944434533 2:199672868-199672890 CCCACCCTCTTCTGTTTGGTAGA No data
Right 944434539 2:199672905-199672927 CCTGACCCATGTTCAAAGGAAGG No data
944434533_944434537 10 Left 944434533 2:199672868-199672890 CCCACCCTCTTCTGTTTGGTAGA No data
Right 944434537 2:199672901-199672923 TAAACCTGACCCATGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944434533 Original CRISPR TCTACCAAACAGAAGAGGGT GGG (reversed) Intergenic
No off target data available for this crispr