ID: 944437394

View in Genome Browser
Species Human (GRCh38)
Location 2:199704855-199704877
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944437394_944437397 8 Left 944437394 2:199704855-199704877 CCACAGACATAGAGATCCAAGCA No data
Right 944437397 2:199704886-199704908 GCAAAATATGCTATAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944437394 Original CRISPR TGCTTGGATCTCTATGTCTG TGG (reversed) Intergenic
No off target data available for this crispr