ID: 944437859

View in Genome Browser
Species Human (GRCh38)
Location 2:199710331-199710353
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944437856_944437859 17 Left 944437856 2:199710291-199710313 CCTTATGGAGAGAATATATGAGT No data
Right 944437859 2:199710331-199710353 GGTGTGAGTTATGGTGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr