ID: 944437983

View in Genome Browser
Species Human (GRCh38)
Location 2:199711805-199711827
Sequence ATTCCTGGGTTTCCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944437973_944437983 16 Left 944437973 2:199711766-199711788 CCACACCTGGCTGGAAGCAACCA No data
Right 944437983 2:199711805-199711827 ATTCCTGGGTTTCCACATCCTGG No data
944437975_944437983 11 Left 944437975 2:199711771-199711793 CCTGGCTGGAAGCAACCAAAGGG No data
Right 944437983 2:199711805-199711827 ATTCCTGGGTTTCCACATCCTGG No data
944437979_944437983 -4 Left 944437979 2:199711786-199711808 CCAAAGGGATGGGCTTCCAATTC No data
Right 944437983 2:199711805-199711827 ATTCCTGGGTTTCCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944437983 Original CRISPR ATTCCTGGGTTTCCACATCC TGG Intergenic
No off target data available for this crispr