ID: 944441369

View in Genome Browser
Species Human (GRCh38)
Location 2:199746907-199746929
Sequence TCCCACTACCTTAAACGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944441365_944441369 -10 Left 944441365 2:199746894-199746916 CCTCCCTCACGCCTCCCACTACC No data
Right 944441369 2:199746907-199746929 TCCCACTACCTTAAACGTCTTGG No data
944441362_944441369 8 Left 944441362 2:199746876-199746898 CCTTCTTAACTCCTCTTCCCTCC No data
Right 944441369 2:199746907-199746929 TCCCACTACCTTAAACGTCTTGG No data
944441363_944441369 -3 Left 944441363 2:199746887-199746909 CCTCTTCCCTCCCTCACGCCTCC No data
Right 944441369 2:199746907-199746929 TCCCACTACCTTAAACGTCTTGG No data
944441364_944441369 -9 Left 944441364 2:199746893-199746915 CCCTCCCTCACGCCTCCCACTAC No data
Right 944441369 2:199746907-199746929 TCCCACTACCTTAAACGTCTTGG No data
944441361_944441369 20 Left 944441361 2:199746864-199746886 CCAAACGATGATCCTTCTTAACT No data
Right 944441369 2:199746907-199746929 TCCCACTACCTTAAACGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944441369 Original CRISPR TCCCACTACCTTAAACGTCT TGG Intergenic
No off target data available for this crispr