ID: 944445257

View in Genome Browser
Species Human (GRCh38)
Location 2:199782495-199782517
Sequence ACATAGCTTCTCTACTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944445247_944445257 27 Left 944445247 2:199782445-199782467 CCCTTTTCAATTTACTATTTTGA No data
Right 944445257 2:199782495-199782517 ACATAGCTTCTCTACTGGGAAGG No data
944445248_944445257 26 Left 944445248 2:199782446-199782468 CCTTTTCAATTTACTATTTTGAT No data
Right 944445257 2:199782495-199782517 ACATAGCTTCTCTACTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944445257 Original CRISPR ACATAGCTTCTCTACTGGGA AGG Intronic
No off target data available for this crispr