ID: 944450345

View in Genome Browser
Species Human (GRCh38)
Location 2:199835983-199836005
Sequence GAAGTGGTTGGCTGGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944450336_944450345 -9 Left 944450336 2:199835969-199835991 CCTTTTACCTAGGTGAAGTGGTT No data
Right 944450345 2:199835983-199836005 GAAGTGGTTGGCTGGGGAGGGGG No data
944450333_944450345 20 Left 944450333 2:199835940-199835962 CCTGGTTTAACACTGAGTGTCTT No data
Right 944450345 2:199835983-199836005 GAAGTGGTTGGCTGGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944450345 Original CRISPR GAAGTGGTTGGCTGGGGAGG GGG Intronic
No off target data available for this crispr