ID: 944450452

View in Genome Browser
Species Human (GRCh38)
Location 2:199836752-199836774
Sequence AAACCCTGTTTCAAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944450450_944450452 5 Left 944450450 2:199836724-199836746 CCACTGCACTCAGCCTGGGTGAC 0: 239
1: 546
2: 951
3: 1454
4: 2842
Right 944450452 2:199836752-199836774 AAACCCTGTTTCAAAAAAAAAGG No data
944450451_944450452 -8 Left 944450451 2:199836737-199836759 CCTGGGTGACAAAGCAAACCCTG No data
Right 944450452 2:199836752-199836774 AAACCCTGTTTCAAAAAAAAAGG No data
944450447_944450452 16 Left 944450447 2:199836713-199836735 CCACAATCATGCCACTGCACTCA No data
Right 944450452 2:199836752-199836774 AAACCCTGTTTCAAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944450452 Original CRISPR AAACCCTGTTTCAAAAAAAA AGG Intronic
No off target data available for this crispr