ID: 944452950

View in Genome Browser
Species Human (GRCh38)
Location 2:199861643-199861665
Sequence CCTTCTTTGCTGATTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944452950_944452953 -4 Left 944452950 2:199861643-199861665 CCATGTACAATCAGCAAAGAAGG No data
Right 944452953 2:199861662-199861684 AAGGGATGTGCCAACAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944452950 Original CRISPR CCTTCTTTGCTGATTGTACA TGG (reversed) Intergenic
No off target data available for this crispr