ID: 944457614

View in Genome Browser
Species Human (GRCh38)
Location 2:199911533-199911555
Sequence GCCGCTGCCGCCCGGGTTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3053
Summary {0: 1, 1: 0, 2: 30, 3: 589, 4: 2433}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944457614_944457619 5 Left 944457614 2:199911533-199911555 CCATGAACCCGGGCGGCAGCGGC 0: 1
1: 0
2: 30
3: 589
4: 2433
Right 944457619 2:199911561-199911583 GCGATGCTCCCTCTCGGCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 51
944457614_944457618 -1 Left 944457614 2:199911533-199911555 CCATGAACCCGGGCGGCAGCGGC 0: 1
1: 0
2: 30
3: 589
4: 2433
Right 944457618 2:199911555-199911577 CGGCGCGCGATGCTCCCTCTCGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944457614 Original CRISPR GCCGCTGCCGCCCGGGTTCA TGG (reversed) Exonic
Too many off-targets to display for this crispr