ID: 944457616

View in Genome Browser
Species Human (GRCh38)
Location 2:199911540-199911562
Sequence GCGCGCCGCCGCTGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 1, 2: 8, 3: 94, 4: 508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944457616_944457619 -2 Left 944457616 2:199911540-199911562 CCCGGGCGGCAGCGGCGGCGCGC 0: 1
1: 1
2: 8
3: 94
4: 508
Right 944457619 2:199911561-199911583 GCGATGCTCCCTCTCGGCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 51
944457616_944457618 -8 Left 944457616 2:199911540-199911562 CCCGGGCGGCAGCGGCGGCGCGC 0: 1
1: 1
2: 8
3: 94
4: 508
Right 944457618 2:199911555-199911577 CGGCGCGCGATGCTCCCTCTCGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944457616 Original CRISPR GCGCGCCGCCGCTGCCGCCC GGG (reversed) Exonic
900088674 1:909972-909994 CCGCGCCGCCGCCCCTGCCCAGG - Intergenic
900589950 1:3454988-3455010 GAGCCCCGCCTCTCCCGCCCCGG - Intronic
900640032 1:3684222-3684244 CCGCCCCGCCTCCGCCGCCCAGG + Intronic
900787074 1:4655764-4655786 GCGCGCCGGGGCAGCCGGCCAGG - Intronic
900796576 1:4712034-4712056 GGTCGCCGCCCCGGCCGCCCCGG + Exonic
900970902 1:5992070-5992092 GCGCGCCACCGCCGCACCCCAGG + Intronic
901109611 1:6784851-6784873 GCCCGCCGCCGCTGCCGGTGGGG - Intergenic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
903186313 1:21631235-21631257 CCCCGCAGCTGCTGCCGCCCAGG - Intronic
903263521 1:22143372-22143394 GCGCGCCGCCGAGCCCGGCCCGG + Intronic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903750212 1:25616799-25616821 CCCCGCCGCCGCCGCCGCTCGGG - Intergenic
904171113 1:28592672-28592694 GCGCGCTGCAGCTGCGGGCCGGG + Intronic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904251892 1:29230971-29230993 GCGCCCCGCCCCTGCCCCGCCGG + Intergenic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
905108369 1:35577229-35577251 CCTCGCCGCCGCAGCTGCCCTGG - Intronic
905449165 1:38046230-38046252 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
905584343 1:39105334-39105356 GCCCGCCGCTGCAGCCGCGCCGG + Intronic
905626283 1:39492154-39492176 GCGCGGGGCCGGGGCCGCCCGGG - Exonic
905670613 1:39788301-39788323 GCGCGGGGCCGGGGCCGCCCAGG + Exonic
905867030 1:41382128-41382150 CCGCGCCGCCGCCGCCGTGCAGG - Exonic
906117937 1:43367924-43367946 GCGCTCCGCCGTTGCCCGCCTGG - Intronic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
907490490 1:54806078-54806100 GCCCGCCTCCGCTGCTGCCACGG - Intronic
908355811 1:63323939-63323961 GAGCGCCGCCGCAGCAGCCGCGG - Exonic
908355846 1:63324102-63324124 GGGCGCCGCCGCGGCCGCTGCGG + Exonic
910449050 1:87328724-87328746 CCGAGCCGCCGCTGCCATCCCGG + Exonic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912270210 1:108200541-108200563 ACGCGCTGACGCTGCAGCCCTGG - Intronic
912401555 1:109397743-109397765 CCGCTGCGCCGCTGCCGCGCTGG - Exonic
914869123 1:151458819-151458841 GCGCGCCGCGGCGGGCGCCGGGG + Intronic
914919561 1:151838277-151838299 AGGCGCAGCCGCAGCCGCCCGGG + Exonic
916802185 1:168225961-168225983 GCGCGCCGCGGTTGGCGCCTGGG + Intronic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
918114176 1:181482881-181482903 GCTCGCCACCGCCGCCTCCCCGG - Intronic
918283009 1:183023736-183023758 CCGCGCCGGCCCTGCGGCCCCGG + Exonic
918388764 1:184037056-184037078 GCGTCCCGCCGCGGCGGCCCGGG + Intronic
918390173 1:184051692-184051714 GCGCGCCGCTGCTTCTGGCCGGG + Exonic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
920385631 1:205568900-205568922 AGGCGCCCCCGCCGCCGCCCGGG + Intronic
920850656 1:209625951-209625973 GGCCGCTGCCTCTGCCGCCCTGG - Exonic
921039532 1:211416657-211416679 CGGCGCCGCCGCTGCTGCCTCGG - Intergenic
921089603 1:211830522-211830544 GCCCGGCTCCGCTGCCGCTCTGG + Intronic
921152770 1:212414913-212414935 GCGCCTGGCCGCTGCCGCCCAGG + Intergenic
922539492 1:226408151-226408173 GCGCGCGCCCCCTGCCGGCCGGG + Intergenic
922676778 1:227558460-227558482 CTGCGCCCCCGCTGCAGCCCGGG + Intergenic
922677891 1:227563878-227563900 CTGCGCCGCGGCTTCCGCCCCGG + Intronic
922937259 1:229432245-229432267 GCGCGGCGCCCCTGCACCCCGGG - Intronic
923079784 1:230642382-230642404 GGGGGCCGCCGCTGCTGCACGGG - Intergenic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924754978 1:246932244-246932266 GCGCGCCGCCGGGGCCGCCAGGG - Intergenic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1064859773 10:19815553-19815575 GGTCCCCGCCGCTGCCGCCGCGG - Intergenic
1064981956 10:21174165-21174187 CCTCGCCGCCGCCGCCGCGCAGG + Intronic
1065101184 10:22334764-22334786 CCGCGAAGCCGCTGCCTCCCCGG - Intergenic
1065140462 10:22714416-22714438 GCGCGCCGGGGCCGCCGCCGGGG - Exonic
1065844716 10:29735541-29735563 GCGCCCCGTCGCAGCGGCCCGGG + Intronic
1065844950 10:29736399-29736421 GCTAGCCCCCGCTGCAGCCCCGG + Intronic
1067363177 10:45600839-45600861 GCCTGCCGGCCCTGCCGCCCCGG + Intergenic
1067436532 10:46282868-46282890 GCGCATCGCCGCGGCCCCCCTGG + Intergenic
1067937442 10:50623894-50623916 GCCCGCAGCCGCTGCCCCGCTGG + Exonic
1068954021 10:62805517-62805539 TCGAGCCGCCGCTGCAGCCCCGG + Exonic
1069438501 10:68407186-68407208 CCGCGCAGCCGCCGCCGCCATGG - Exonic
1069761812 10:70816247-70816269 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1069992955 10:72326051-72326073 GCCCGCCGGCCCTGCCGCCCCGG + Intergenic
1070570673 10:77637841-77637863 GCGAGCCGCCGCCGCCCGCCCGG + Intronic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071527464 10:86366645-86366667 GCGGGCCGCCCCCGCCGCGCCGG - Intergenic
1071996469 10:91153913-91153935 GCGCACTCTCGCTGCCGCCCTGG + Intergenic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1072409069 10:95183875-95183897 ACCTGCCGCCGCCGCCGCCCCGG + Intergenic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1073137735 10:101229054-101229076 GCGCGCCCCGGCTCCGGCCCCGG - Exonic
1073266421 10:102230804-102230826 GCCCTCCGCCGCGGCTGCCCCGG - Exonic
1073287877 10:102399364-102399386 GCGCCCCGCCCCCGCCTCCCGGG - Exonic
1074182578 10:111077294-111077316 CCCCGCCGCCGCCGCCGTCCCGG + Exonic
1075645454 10:124093304-124093326 GCGCGCCGCCTCCGCCGGCCCGG + Intronic
1075748568 10:124744526-124744548 CCGCGCCACCGCGGCTGCCCGGG + Intronic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076722037 10:132397014-132397036 GCCCGCCGCCGCCGCGTCCCGGG - Intergenic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1077674967 11:4187455-4187477 TCGCGCTGCCGCCGCCGCCGCGG - Intergenic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1079128497 11:17734829-17734851 CCGCGACGCTGCTGCCGCCCGGG - Exonic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080551343 11:33376229-33376251 TCCCGCCGCCGCTGCAGCCTCGG - Intergenic
1080701303 11:34646622-34646644 CCCCGCCGTCCCTGCCGCCCGGG - Exonic
1081492584 11:43579622-43579644 GCCCGCCGCCGCCGCGGCGCGGG - Intronic
1081636877 11:44727317-44727339 GCACGCCGCCGCCGCGCCCCCGG + Intronic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083437604 11:62653269-62653291 GCGCTCCGCCGCTCGCGCCTCGG - Exonic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1085332821 11:75667730-75667752 GCAGGCCGCCGCTGAGGCCCGGG - Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1089560300 11:119340223-119340245 GCGCGCCGTCGCGGCCGTCGCGG + Exonic
1089700234 11:120240171-120240193 GCGCTCCGCTGCTCCGGCCCGGG - Intronic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090859950 11:130644205-130644227 GCGGGCCGCCTCTGCAGCTCAGG + Intergenic
1091243264 11:134069284-134069306 GCGCGCCGCCCCTCCGGCCCGGG - Intronic
1091263627 11:134253631-134253653 GCGCGCCTCGGCTGCCTGCCCGG + Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558654 12:1594365-1594387 GCCGGCCGCCGCCGCCGCCTCGG + Intronic
1091688993 12:2583141-2583163 GCGCGGCGCCGCTGCGGGCCCGG - Intronic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1092796044 12:12111058-12111080 GCGCGCCTCCTCCGCCGCCGCGG + Intronic
1093464846 12:19439376-19439398 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1094041838 12:26126639-26126661 GCGAGCGGCCGCCGCGGCCCGGG - Intronic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1095703630 12:45216064-45216086 GCGAGCCGCGGCGGCCGCACTGG + Exonic
1095752868 12:45729941-45729963 TCGCCCCGGCGCTGCCCCCCCGG - Intronic
1095776692 12:46018114-46018136 GCGGGCTGGCCCTGCCGCCCTGG + Intergenic
1096622688 12:52874336-52874358 GGGCGCGGCCGGCGCCGCCCTGG - Intergenic
1097990336 12:65825883-65825905 GCGCGCCGCAGCCGCCCCCTTGG + Intronic
1098819151 12:75207765-75207787 GAGCGCCCCCGCTGTCCCCCGGG - Exonic
1099014141 12:77324999-77325021 GCGCGGCGCCTCTCCCGGCCCGG - Intergenic
1099989765 12:89709325-89709347 CGCCGCCGCCGCTGCCGCCTTGG + Intergenic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1100565428 12:95790277-95790299 GCGCGCGGCTGCTGCTGCTCTGG - Exonic
1100565623 12:95790909-95790931 CGCCGCTGCCGCTGCCGCCCGGG + Intronic
1100611400 12:96194356-96194378 CCGCGCCTCCCCCGCCGCCCCGG - Intergenic
1100869443 12:98894981-98895003 CGCCGCCGCCGCTGCCGCCAGGG - Intronic
1100869547 12:98895339-98895361 CCGCGCCGCTGCTACCGCCCCGG - Intronic
1100963046 12:99984662-99984684 GCGGGCCGCTGCTGCCACCGCGG - Intergenic
1101680054 12:106955968-106955990 GCCGGCCGCCGCTGCCGCCCAGG + Exonic
1102256512 12:111418516-111418538 TGGCCCCGCCGCGGCCGCCCGGG + Exonic
1102457189 12:113078001-113078023 GCGCTCCGCCGGGGGCGCCCGGG - Exonic
1102558183 12:113742587-113742609 CAGCGCCGCTGCTGCTGCCCAGG - Intergenic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104448851 12:128853563-128853585 GCATGCCGCCGCCGCCGCCCGGG - Exonic
1104862038 12:131929028-131929050 TCGCTCCGCCGCCGCCTCCCGGG - Intergenic
1105000646 12:132687830-132687852 CCGCGCCGCTGCGGCCGACCTGG - Intronic
1105203065 13:18195321-18195343 CCACGCCGCCGATGCTGCCCGGG - Intergenic
1105512242 13:21060982-21061004 CCGCGCCGCCCCTGCCCCGCCGG + Intronic
1105512406 13:21061466-21061488 CCACGCCACCGCCGCCGCCCGGG - Exonic
1105855273 13:24366300-24366322 GAGCGCCGGCCCTGCTGCCCTGG + Intergenic
1105890712 13:24680678-24680700 GCGCTCCGCCGCTGCGGTCCCGG + Exonic
1106517167 13:30465403-30465425 CCGCGCCGGCCCCGCCGCCCCGG + Intronic
1106568511 13:30906694-30906716 CCGCGCCGCCGCCGGCTCCCCGG - Exonic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1107078250 13:36346481-36346503 GCACGCCGCCGCCGCAGCCTAGG + Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107836098 13:44413672-44413694 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
1108227457 13:48303945-48303967 CACCGCCGCCGCTGCCGCCGCGG + Exonic
1110705921 13:78602143-78602165 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1110965488 13:81689963-81689985 GCGCGCCTCCTCCGCCGCCGCGG + Intergenic
1111951250 13:94711292-94711314 GCGAGCGGCGGCTGCAGCCCGGG + Exonic
1112505166 13:99970904-99970926 CCGGGCCGCCGCTGCCGTCCGGG + Exonic
1112613083 13:100975793-100975815 GCGGGCCGGCCCTGCCGGCCCGG + Intergenic
1112652759 13:101416509-101416531 GAGCGCCGCCGCCGCCGGGCAGG + Intergenic
1113082328 13:106533229-106533251 CCGCGGCGCCGCTGCCCGCCCGG - Intronic
1113812114 13:113149295-113149317 GCGGGCCCCCGCTGTCCCCCTGG - Exonic
1115320708 14:32076993-32077015 CCGCGCCGCCGCTCCGCCCCCGG + Intronic
1117176687 14:53153029-53153051 AGGCGCCGCCGCCGCCGCCTCGG + Exonic
1117176780 14:53153371-53153393 GCGCGGCGCCGGTGCAGCCCGGG - Intergenic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1117876041 14:60250076-60250098 GCGCGCCGCCCCGGCTGTCCTGG + Intronic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1119602510 14:75986005-75986027 GGGCTCCGCCGCTGCTGGCCTGG + Intronic
1120788124 14:88555035-88555057 ACGGGCCGCCGCCGCCTCCCCGG - Intergenic
1121690894 14:95876570-95876592 GCGCCCCGCCGCTGCGGTCGCGG + Intergenic
1121767797 14:96502530-96502552 AACCGCCGCCGCTGCCGCCCTGG - Exonic
1122275047 14:100586997-100587019 GCGCGCCGCCGGGAGCGCCCGGG - Intronic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122558306 14:102593006-102593028 GCCAGCCGCCACTGCCGCCTCGG + Exonic
1122789546 14:104178546-104178568 AGGCGCCGCCGCTGCAGACCTGG - Exonic
1122844144 14:104481570-104481592 GAGCACCGCCCCTGCTGCCCCGG + Intronic
1122866115 14:104604748-104604770 TCCCGCCGCCGCTCTCGCCCGGG - Exonic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1123041297 14:105491326-105491348 GCCCGCCTCCGCCGCGGCCCGGG - Exonic
1123219844 14:106844953-106844975 TCTCGCCGCCGCAGCCTCCCTGG + Intergenic
1124427010 15:29570844-29570866 GCGCGCGGCCGCCGCAGCCCTGG - Intergenic
1124453700 15:29821977-29821999 GAGCGCCTCCGCGGCCGCCAGGG - Intronic
1124743137 15:32315382-32315404 GCGCGGCCCCGAGGCCGCCCCGG + Intergenic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125516427 15:40323715-40323737 GCGCTCCGCCGCCGCCTGCCCGG - Intergenic
1125522908 15:40358139-40358161 GCGCGGCGCCGCTGCCGGAGCGG - Intergenic
1125672898 15:41486423-41486445 GCGCGCGGCCGCTGCGTTCCAGG + Intergenic
1126649734 15:50908697-50908719 CCCGGCCGCCGCTGCCGGCCCGG - Exonic
1126668419 15:51094694-51094716 CCGCGCCGCCCGCGCCGCCCGGG - Intronic
1127142638 15:55993430-55993452 GGCCGCCGCCGCTACCTCCCCGG + Intronic
1127207160 15:56733221-56733243 GCGCGACGCGGCAGCCGCCTCGG - Intronic
1127606539 15:60592608-60592630 GCGCCCCTCCGCTTCCTCCCGGG + Intronic
1127766080 15:62186826-62186848 GCCCGCTGGCCCTGCCGCCCCGG - Intergenic
1127789891 15:62390444-62390466 GCGCGGCGCCGCGGCCGGACCGG + Intergenic
1127931659 15:63601043-63601065 CCGCCCCGCCGCTGCCCCCGGGG + Intronic
1129107258 15:73318862-73318884 GCGCCCTGCCTCTGCCGCTCCGG + Intergenic
1129483027 15:75843129-75843151 GCGCGCCCCCGCCCCCGGCCTGG - Intergenic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1132055539 15:98648452-98648474 GCGCGCCGCTGCTGCGGCGGTGG + Intergenic
1132519790 16:381866-381888 GCCGGCCCCCGCCGCCGCCCGGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1133156500 16:3880244-3880266 GGGCGCCGTCGCTGCCAGCCGGG - Exonic
1133188392 16:4116159-4116181 GTGCGCCGCCGCTCCCGCCGCGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1135034732 16:19067675-19067697 GCGGGGAGCCGCCGCCGCCCCGG - Exonic
1135091492 16:19521733-19521755 GCGCGTCGTGGCTGCCGCCACGG + Exonic
1135517684 16:23149223-23149245 GCTCGCCGCCGCCGGCGGCCCGG + Exonic
1135691318 16:24539913-24539935 CCCCGCCGCCGCCGCCGCCTCGG - Intronic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136626411 16:31464786-31464808 GCGCGGCGCTGCTGCGGGCCTGG + Exonic
1136630858 16:31488557-31488579 TCGCGCAGCTGCAGCCGCCCTGG + Intronic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1137426559 16:48385348-48385370 GCGCCCCGCAACGGCCGCCCCGG + Intronic
1138561371 16:57802560-57802582 GCGCGCCGCCGCCCCCCGCCGGG - Exonic
1138595172 16:58025897-58025919 GCTCGCCGCCGCGCCCGACCGGG - Exonic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139500769 16:67362923-67362945 GCGCGCCACCACTCCCGGCCCGG + Intronic
1139549182 16:67663995-67664017 GCGCACTCCCGCTGCGGCCCTGG - Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1142124694 16:88404359-88404381 ACGCACCGCCGGCGCCGCCCAGG - Intergenic
1142859105 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG + Intergenic
1143150767 17:4806858-4806880 GTGCCCGGCCGCTGCCTCCCGGG - Intergenic
1143498419 17:7325294-7325316 CCGTGCTGCCCCTGCCGCCCAGG - Exonic
1143583918 17:7842119-7842141 GCGCAGCGCCGCAGCCGCGCGGG - Intronic
1145128392 17:20320539-20320561 GCGCGCAGCGGCTGCGGCACAGG + Intergenic
1145196220 17:20896675-20896697 GCGCGCAGCGGCTGCGGCACAGG - Intergenic
1146053005 17:29567450-29567472 GCGCGCGGCCGCCGCCCCACGGG - Intronic
1146057698 17:29589437-29589459 AGGGGCCGCCGCCGCCGCCCGGG - Exonic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1148157691 17:45432878-45432900 GCTCTCCGCCGGTGCCTCCCTGG - Intronic
1149634667 17:58157090-58157112 GCGCTCCTCCGCGGCCGCCTCGG - Intergenic
1150562142 17:66303085-66303107 GCGCTCCGGCGCGTCCGCCCCGG + Intronic
1150764633 17:67993571-67993593 GCGCGCCGCCGCGCTGGCCCCGG - Intronic
1150778722 17:68101883-68101905 GCCCGCCGCCCCAGCCGCCAGGG + Intergenic
1150790069 17:68196326-68196348 GCTCTCCGCCGGTGCCTCCCTGG + Intergenic
1150791919 17:68205834-68205856 GTGGGCCGCCGCCGCCGCCTAGG + Intergenic
1151612168 17:75183150-75183172 GCGCGCCCCCGCGGCGGGCCGGG - Intergenic
1152082907 17:78199653-78199675 GTGCGCCGCCGCGCCCGGCCAGG + Intronic
1152552191 17:81035386-81035408 GCGCGGCCCCGGGGCCGCCCTGG - Intronic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152565466 17:81098273-81098295 GAGGGCGGCCGCTGCCTCCCAGG - Intronic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1152721889 17:81927482-81927504 CCGCGCCGCCCCCACCGCCCGGG + Intronic
1152729123 17:81961254-81961276 ATGTGCCGCCGCCGCCGCCCGGG + Exonic
1152789968 17:82273574-82273596 GAGCGCCGCCGCCGCTGCTCCGG + Exonic
1153457177 18:5295128-5295150 TCGCGCCGCCGGGGCCGCCGCGG - Intronic
1153805309 18:8705327-8705349 GCGCGCCGCCAGCGCCGCCGCGG + Intergenic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154294632 18:13137550-13137572 GAGCTCCGCCGCTGCGCCCCTGG + Intergenic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1156008520 18:32470710-32470732 GGGAGCCGCCGCAGCCACCCGGG - Intergenic
1156038654 18:32794672-32794694 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
1157384052 18:47247479-47247501 AGTCCCCGCCGCTGCCGCCCGGG + Intronic
1157384178 18:47247881-47247903 GGGTGCCGCCGCTGAGGCCCTGG - Intronic
1157610081 18:48950552-48950574 GGCCGCCGCCGCTCCTGCCCGGG - Exonic
1157753070 18:50195181-50195203 CCGCGCCCCCGCTGCCACCTGGG + Intergenic
1158648860 18:59269289-59269311 TCGGGCCGCCGCTGCCGGGCGGG - Exonic
1158648868 18:59269313-59269335 GCGCGCTGCCGCTGGAGTCCTGG - Exonic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1158976691 18:62716436-62716458 GCCCGGAGCCGCCGCCGCCCGGG + Exonic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160592160 18:79951058-79951080 GCGCGCCGCCCCAGCCTCCCTGG - Intronic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160858711 19:1228711-1228733 GCGCCCCGCGGCCCCCGCCCGGG + Exonic
1160865515 19:1254298-1254320 GGCCGCCGCCGCTGCTGCGCGGG + Exonic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160967914 19:1754574-1754596 GGCCGCCGCCGCTCCCGCCGGGG - Exonic
1161006796 19:1941201-1941223 GCGCTCCGCCGCGCCCGCTCCGG - Exonic
1161233235 19:3186008-3186030 GCGCGGCCCCGCCGCCGGCCAGG + Exonic
1161264868 19:3359526-3359548 GCGCGCCGCGCCCGCCCCCCCGG - Intergenic
1161461887 19:4402658-4402680 CCGCGCCGCTGCTGCCGCCGCGG - Exonic
1161560267 19:4969189-4969211 GCGCGCCGCTGCTCCCGGACCGG + Exonic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1162751794 19:12833949-12833971 AGTCGCCGCCGCTGCCGCCATGG + Intronic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1162954294 19:14089946-14089968 CGGCGCCGCCGCTGCCCCCGAGG + Exonic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163398110 19:17075837-17075859 GCGCGCCGCCGGTCCCGGGCCGG - Exonic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1164835081 19:31350766-31350788 CCGCTCAGCCGCCGCCGCCCGGG - Intergenic
1164992175 19:32692370-32692392 GCGTGCTGCTGCTGCGGCCCAGG + Exonic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165089157 19:33373690-33373712 GCGCGCCGCCGCCGCCATCCCGG - Exonic
1165509435 19:36257562-36257584 AAGCGCCGCCACCGCCGCCCCGG + Intergenic
1165532737 19:36417877-36417899 ACGAGCCCCCGCTCCCGCCCAGG - Intronic
1165879417 19:39031984-39032006 GCGCGCGGCCGGTGGCGCCGTGG + Exonic
1165939827 19:39409609-39409631 GCGCGGCGCCCCCGACGCCCGGG - Intergenic
1165956951 19:39507068-39507090 CTGCGCTGCCGCTGCCGCGCCGG + Exonic
1166205161 19:41264727-41264749 CCGCGCAGCCACCGCCGCCCGGG + Exonic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1166290530 19:41860476-41860498 GCACCCCGCCGCTGCCCCCCGGG - Intronic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167309538 19:48729068-48729090 GCGCGCCGCAGCCGCCGGCTCGG - Exonic
1167464262 19:49641987-49642009 GCGCACCGCCTCTGTCGCGCGGG - Intergenic
1168230391 19:55027288-55027310 TGGCGCCGCCCCTGCAGCCCAGG + Intronic
1168315152 19:55481868-55481890 GCACGGCGCCGCCCCCGCCCCGG + Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
926250948 2:11155299-11155321 CCGCCCCGCCCCTCCCGCCCGGG - Intronic
926250965 2:11155328-11155350 CCGCCCCGCCCCTCCCGCCCGGG - Intronic
927714183 2:25341798-25341820 GAGCGCCGCTGCTGGCGGCCCGG - Intronic
927881483 2:26692797-26692819 GGCCGCCGCTGCTGCTGCCCCGG - Exonic
927937969 2:27086124-27086146 GCGCGGTGCCGCTGCGGGCCCGG - Exonic
928278059 2:29920537-29920559 CGGGGCCGCCGCTGCAGCCCCGG - Exonic
928540275 2:32278078-32278100 GGTCGCCGCCGCGGCCGCCTCGG + Exonic
930011521 2:46941400-46941422 CCGGGCCCCCGCTGCCGCCCGGG + Exonic
930124163 2:47783329-47783351 CCGTGCCGCCGCTGCCCCCGGGG + Exonic
931392184 2:61853907-61853929 GATCGCCTCCGCTGCCGCCAGGG + Exonic
932313991 2:70767740-70767762 GCGCGTCGGTGCTGCAGCCCTGG - Intronic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
932780602 2:74556326-74556348 GCCGGCCGCCGCTGCCCCTCAGG + Exonic
933666981 2:84971628-84971650 CCGCGGCGCCGCTGCCGCCACGG + Intronic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934564587 2:95331171-95331193 TCCCGCCTCCGCTGCCACCCTGG - Intronic
936585827 2:113756699-113756721 GCGCGCCACCGCTTCCGGGCTGG - Exonic
938368794 2:130756147-130756169 GCGGGCCGGCGCTGGCGCGCAGG - Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
940038038 2:149330489-149330511 GCCCGCAGCCGCGGCCGGCCCGG - Intronic
940265134 2:151828359-151828381 AGGCCCCGCCGCTGCCGCCGCGG + Exonic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
941951496 2:171160835-171160857 GCCCGCCGCCGCCGCCTCCCGGG - Intronic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
943060653 2:183038499-183038521 GGGCGCCGGCGCTGCCGATCAGG - Exonic
943185165 2:184598312-184598334 GCGCGGCGCCGCTGCCGCAGAGG - Intergenic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946306498 2:218859656-218859678 GCGCTCCGCGCCAGCCGCCCCGG + Intergenic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946422214 2:219571303-219571325 GCGCCCCGACCCCGCCGCCCCGG - Intronic
946692479 2:222319730-222319752 GCCCGCCGCGCCCGCCGCCCTGG - Intergenic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947641162 2:231708602-231708624 GCGCGCCTCCTCCGCCGCCGCGG + Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948213856 2:236214614-236214636 GCGCGCTGCTGCTGCGGCGCGGG - Exonic
948473720 2:238203410-238203432 GGGCGCCGCCTCAGCCGCCCCGG + Intronic
1168757103 20:325520-325542 GCGCGCCGGCGGGGCCGCGCGGG + Exonic
1168855068 20:1002358-1002380 ACGCGCCGCCCCCGCCGCGCCGG - Intergenic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1172083173 20:32358519-32358541 GGCAGCCGCCGCTGCCGCCGTGG + Exonic
1172793401 20:37521330-37521352 GGCCGCCGCCACTGCCGCCATGG - Exonic
1172962022 20:38806268-38806290 GCGCCCTGCCGCTGCCCGCCAGG - Intronic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173813584 20:45971272-45971294 CAGCGACGCCGCGGCCGCCCCGG - Exonic
1174330408 20:49812964-49812986 CCCCGCCGCCTCCGCCGCCCGGG - Intronic
1174506948 20:51023115-51023137 GCGCGGCGCAGCAGCCGCCGAGG + Exonic
1175266960 20:57709200-57709222 GTGCGCCGCCGCTGAGCCCCGGG + Intronic
1175268711 20:57718770-57718792 AGCCGCCGCCGCTGCAGCCCCGG - Intergenic
1175856278 20:62122541-62122563 GCCCGCCGCCGCCTCCGCCTGGG - Exonic
1176201266 20:63861692-63861714 GCCCGCCGCGGCTGCCGCGCAGG - Exonic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176714895 21:10342684-10342706 CCACGCCGCCGATGCTGCCCGGG + Intergenic
1178350915 21:31872881-31872903 GCGCGCCTCCGAGGCCGCGCAGG + Intergenic
1178992480 21:37367197-37367219 AGGAGCCGCCGCCGCCGCCCGGG + Intronic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1180603453 22:17037254-17037276 CCACGCCGCCGATGCTGCCCGGG - Intergenic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180733822 22:18001231-18001253 GCGCGCCGAGCCTCCCGCCCGGG - Intronic
1181087707 22:20449957-20449979 AAGCGTCGCCGCCGCCGCCCCGG - Intronic
1181539642 22:23566438-23566460 GCCCGCCCCCGCCGCCCCCCTGG + Intergenic
1182278616 22:29205807-29205829 CTGCGCCGCCGCTGCCAACCCGG - Intergenic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183486184 22:38088887-38088909 TGGCGCCCCCGCCGCCGCCCGGG + Exonic
1183525001 22:38317492-38317514 CCGGCCCGCCGCCGCCGCCCCGG + Intronic
1183601617 22:38843595-38843617 GCGCGCACCCGCTGCCGCCCGGG - Exonic
1183665529 22:39244010-39244032 GCGCGCCGCCCCCGCGGCCAGGG + Exonic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1183912948 22:41092442-41092464 CCGCGCCGCCGCCGCCGCACCGG - Exonic
1184046757 22:41976872-41976894 CCGCGCCGCCGCGCCCTCCCCGG - Exonic
1184164865 22:42721004-42721026 GCGCGCCCTCGCTGCTCCCCGGG + Intronic
1184674861 22:46036119-46036141 AGGCGCCGCGGCTTCCGCCCGGG + Intergenic
1184680681 22:46071050-46071072 GCGCGCCCCAGCAGCCGCCTCGG + Intronic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
950374239 3:12557091-12557113 TCTCGCAGCCGCTGCCGCCTCGG - Exonic
951217700 3:20040420-20040442 AGGCGCCGCCGCCGCCGCCAGGG - Exonic
952644651 3:35640123-35640145 CCGAGCCGCCGCCGCAGCCCTGG + Intronic
952959632 3:38581164-38581186 GCCCGCAGCCCTTGCCGCCCAGG - Exonic
954367814 3:50155515-50155537 CCGTGCCGCCGCCGCCGCCCGGG + Exonic
954575275 3:51672242-51672264 GCGCTCGGCCCCTGCCGCACTGG + Exonic
954763886 3:52897236-52897258 CCGGGCCGCGGCTGCCGCGCAGG + Intronic
959539870 3:107525243-107525265 GGGCGCCGGCGGTGCCTCCCTGG + Intronic
959705660 3:109336727-109336749 GCCCGCCGCTGCTCCCGGCCCGG - Intronic
960386409 3:117026593-117026615 GCGCGCCTCCTCAGCCGCCGCGG + Intronic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961236963 3:125375348-125375370 GGTCGCCGCCACTGCCGGCCCGG + Exonic
961377308 3:126475598-126475620 GCACGGCGGCGCTGCCGCCGAGG - Exonic
961402139 3:126654961-126654983 GGTCGCCGCCGCAGTCGCCCGGG - Intronic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963602579 3:147390951-147390973 ACGCGCCGCCACCGCCGCCGAGG + Exonic
966915827 3:184583715-184583737 CCGCGCCGCCGCAGCCGGCCCGG + Intronic
967118193 3:186360938-186360960 GCGCTGCGCCGCTGCCTCCTCGG - Intronic
967982643 3:195074967-195074989 GCGAGCCACCGCTCCCGGCCTGG - Intronic
968659592 4:1793600-1793622 GTTTGCCGCCGCCGCCGCCCTGG + Intronic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
968820130 4:2843912-2843934 GCGGGCCGCTGCTGCGGGCCAGG + Exonic
968907981 4:3463339-3463361 CCGCGCCGCCGCGCTCGCCCCGG - Exonic
968985405 4:3871959-3871981 GCGCGCCCCCACTGCCATCCAGG + Intergenic
969597836 4:8158898-8158920 CCGCGCCCCCGCTGCCGCCCGGG + Intergenic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
971244084 4:24912928-24912950 TCGCGTCGCCGCCGCCGCCCGGG + Intronic
972396658 4:38664107-38664129 GGGAGCCGCCGCGGCCGCCCGGG - Intergenic
972418699 4:38867565-38867587 GCGCGCCGCCTCTCCAGCCCAGG - Intergenic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
975883593 4:78939344-78939366 CCGCGCTGCCGCTGCTGCCCAGG + Exonic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
976431241 4:84966002-84966024 GGGAGCCGCCGCCGCCGCCAGGG - Intronic
977810033 4:101347386-101347408 GAGCGCCGCCGCTGGTGCCGCGG + Exonic
977942056 4:102869326-102869348 GCGCGCCGACGCAGCTGCCTGGG + Intronic
978080235 4:104582080-104582102 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
979624277 4:122827596-122827618 GCGCGCCGCGGCTCCGGGCCGGG - Intronic
979832059 4:125315762-125315784 GCGCGCAGACGCCGCCGCCTGGG + Intergenic
980930412 4:139177932-139177954 GCGCGACGCCGGCCCCGCCCCGG + Intergenic
982198387 4:152937284-152937306 GCGCGCGGCCGCCGCAGACCCGG + Intronic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
983940448 4:173530286-173530308 AGGCGCCGCCCCTGCCGCCCCGG - Intergenic
985611628 5:892654-892676 GCCCGCCGCCGGCGCCGCCATGG - Exonic
985696695 5:1344951-1344973 GCGCGCCACCGCCACCGCCGCGG + Exonic
986402840 5:7396196-7396218 CCGCGCCGCCTCGGCCGGCCCGG - Exonic
987379932 5:17275609-17275631 GAGCGCGGCCCCTGCCGCCGGGG + Exonic
987379949 5:17275675-17275697 GCCCGCAGCTCCTGCCGCCCAGG + Exonic
988949398 5:36241866-36241888 GCGCGCCGTCCGCGCCGCCCGGG + Intronic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
991298200 5:65103117-65103139 GCGCCCCGACGCTGCCGGCGCGG + Intergenic
991686849 5:69189517-69189539 GGGCCCCGCCCCTTCCGCCCAGG - Intergenic
992102321 5:73419502-73419524 GCGCCCGGCCGCTCCCGCGCCGG - Intergenic
992105516 5:73447195-73447217 GCAGGCCGCCGCCGCCGCTCAGG - Exonic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
993168387 5:84384680-84384702 GCGGGCTCCCGCGGCCGCCCCGG + Exonic
993770273 5:91917375-91917397 GCGGGCCGGCCCCGCCGCCCGGG + Intergenic
993822019 5:92631431-92631453 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994182643 5:96784408-96784430 GCTCACCGCCTCTGCCTCCCGGG - Intronic
994353835 5:98773860-98773882 GCGCCCCGCTGCTGCCGCCGCGG + Intronic
995032308 5:107494343-107494365 GCCGGCCGGCCCTGCCGCCCGGG + Intronic
995106327 5:108381292-108381314 CGCCGCCGCCGCTGCCGCCTCGG - Exonic
995571704 5:113488382-113488404 CCCCGCAGCCGCTGCCGCCGCGG + Exonic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
997990797 5:138543110-138543132 AGGAGCAGCCGCTGCCGCCCAGG - Exonic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998366832 5:141637465-141637487 GATCGCCTCCGCAGCCGCCCTGG - Exonic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1002175303 5:177398183-177398205 GCTCACCCCCGCTGCCCCCCAGG + Exonic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1002559474 5:180071775-180071797 GCGCGCTCCCGCCGCCGCCCGGG - Exonic
1002569542 5:180132333-180132355 GAGAGCCGTGGCTGCCGCCCAGG - Intronic
1002666771 5:180831184-180831206 GCCCGCCGCCGCCGCCGCCTCGG + Intergenic
1002691398 5:181053070-181053092 GGGCGCCACCGCAGCCGCCTGGG - Intronic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1002928781 6:1619814-1619836 GCGGCCCGCCACTCCCGCCCGGG + Intergenic
1003139122 6:3456645-3456667 GCCTGCAGCCGCTGCCGCCGAGG + Intronic
1003139303 6:3457224-3457246 ACGCGCGGCCGCCGCCGCCCGGG + Intergenic
1003290849 6:4776843-4776865 GCCCGCCGCCCCTCCCGGCCCGG + Intronic
1003325310 6:5086030-5086052 GGGCGCGGCCACTGCCGCCGCGG - Exonic
1003948219 6:11094183-11094205 GCCAGCCGCCCATGCCGCCCCGG + Exonic
1004720429 6:18264162-18264184 CCGCTCCGCCGCCGCCGTCCAGG + Intronic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1006725402 6:36196504-36196526 AGGCGCCGCCGCCGCCGCCACGG - Intergenic
1007327616 6:41073716-41073738 GCCCGCCCCCGCTGTCTCCCTGG + Intronic
1007558108 6:42783149-42783171 GCGCGCCGCCGCCGCGGGCTCGG - Intronic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1012450586 6:99349594-99349616 GGCGGCCGCTGCTGCCGCCCAGG - Exonic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1013793527 6:113859850-113859872 GGCCGCCGCCGCTGCCCCCGAGG + Exonic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1015999654 6:139029523-139029545 GGGCGGCACCGCTGGCGCCCGGG - Intronic
1016949447 6:149566256-149566278 GCGCCTCTCCGCGGCCGCCCGGG + Intergenic
1017164119 6:151391391-151391413 GCGCACCGCCTCCGCCTCCCGGG - Intronic
1017672073 6:156778051-156778073 GGATGCCGCCGCTGCCGCCGCGG - Exonic
1017737902 6:157380867-157380889 CCGCGCAGCAGCTGCCGCCTCGG - Intergenic
1017810709 6:157981742-157981764 GCGCGCCGCCGCCTCCCGCCCGG - Intergenic
1017877404 6:158536416-158536438 GCGCCCATCCGCCGCCGCCCCGG - Exonic
1018613055 6:165662158-165662180 CCCGGCCGCCGCCGCCGCCCCGG - Intronic
1018901849 6:168055639-168055661 GCGCACCTCCCCTGCCGCACAGG + Intergenic
1018975811 6:168564768-168564790 ACGGGCAGCCGCTGCCACCCAGG + Intronic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019076714 6:169393897-169393919 GTGAGCCGCAGCTGCCGCCCAGG - Intergenic
1019743772 7:2688417-2688439 GCCCGTAGCCGCCGCCGCCCGGG - Intronic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1021452775 7:20798055-20798077 GCCCGCGGCCGCCGCAGCCCGGG - Intergenic
1023637587 7:42228070-42228092 CCGCGCCGCCGCCGCGGCCTGGG - Intronic
1024075090 7:45814035-45814057 TCGCCCCACCGCGGCCGCCCGGG - Intergenic
1024520966 7:50304120-50304142 GCCCGCACCCGCCGCCGCCCCGG + Intronic
1026471107 7:70694585-70694607 GCGCGCCGCGGCGGCGGCTCAGG + Intronic
1029351447 7:100015790-100015812 GGGCTCCGCAGCTGCGGCCCTGG + Intronic
1029711119 7:102300568-102300590 TGGCCCCGCCGCAGCCGCCCCGG + Exonic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1031532028 7:122886796-122886818 GCGCGCCGCCGCTGCTGCCCGGG + Intergenic
1032117003 7:129126308-129126330 GCGAGCCGCCGCCGCTGCCGAGG - Intergenic
1032525803 7:132577446-132577468 GCCCGCCGCCGCTCCCTCTCTGG + Intronic
1033137608 7:138798110-138798132 GCGCCTCCCCGCTGCCACCCGGG + Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1033477165 7:141702115-141702137 ACGCGGCGCCGCTGCTGCGCTGG - Exonic
1034347649 7:150397202-150397224 GGGCGCCCCCGCGGCGGCCCCGG - Exonic
1034509252 7:151520562-151520584 GCCCGCCGCACCAGCCGCCCCGG - Intergenic
1034575375 7:151992491-151992513 GGGTGACGCCGCTGCAGCCCGGG - Intronic
1034618183 7:152436281-152436303 CTTCGCCGCCGCCGCCGCCCGGG - Intergenic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035747696 8:1973948-1973970 AGGCCCCGCCGCTGCCTCCCCGG - Intronic
1036390296 8:8318864-8318886 GCCCGCCCCCGCCCCCGCCCCGG - Exonic
1037815450 8:22109477-22109499 GCGCGGCGCCGCGGCCTGCCCGG + Intergenic
1037865748 8:22441099-22441121 GCGAGCAGCCGCGGCCGTCCCGG + Intronic
1039542485 8:38382916-38382938 GCGAGCCGGCGCCGCCGGCCGGG - Intergenic
1041167342 8:55102653-55102675 GCGAGCAGCCGCCGCCGTCCGGG - Exonic
1041271537 8:56113836-56113858 GGGCCCCGCGGCTGCCGCGCCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042859061 8:73295091-73295113 GCGCGGGGCCACTCCCGCCCGGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1043502980 8:80874402-80874424 GCGCGCGGGCGCAGCCGGCCGGG - Intronic
1044138067 8:88611792-88611814 GCACAACGCAGCTGCCGCCCTGG - Intergenic
1044569386 8:93700514-93700536 TCGCGCCGCCGCGGCAGGCCGGG - Exonic
1044819253 8:96144924-96144946 GTGCGCCGCCGCCGGCGGCCGGG + Exonic
1045063453 8:98426917-98426939 GCGTGCCTCGGCCGCCGCCCGGG - Intronic
1045222577 8:100213258-100213280 GCCCGCCGCCGCCGCCGCAGAGG - Exonic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1047262370 8:123274410-123274432 GCGCGCCCCAGCGGCCGTCCGGG + Exonic
1048072847 8:131040150-131040172 TCCCGCTGCCGCTGCCTCCCCGG + Exonic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049406233 8:142452893-142452915 GCGCGCTGCCGCTGACTGCCGGG + Intronic
1049638974 8:143705745-143705767 GCGCGGCGCCGCTCTAGCCCTGG + Intronic
1049798925 8:144508915-144508937 GGGCGGGGCCGCTGCCTCCCGGG - Intergenic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1050455774 9:5832847-5832869 TCGCGCCGCCGCTACCCCCGGGG + Exonic
1051418750 9:16870559-16870581 GAGCGCCACCGGGGCCGCCCGGG - Intronic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1053306211 9:36986348-36986370 GGGCCCCGCCGCGGCCGCGCCGG + Intronic
1053365234 9:37518137-37518159 GCGGGCTGCAGCTGCTGCCCAGG - Exonic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1054407708 9:64775037-64775059 GCCCACCCCCGCTGCCGCCACGG - Intergenic
1054798673 9:69325543-69325565 AGTCGCCGCCGCTGCCGCCGCGG + Intronic
1054842626 9:69759823-69759845 GCGCGCCTCCGCCGCCTCCGAGG - Intronic
1055049343 9:71963637-71963659 GCTGGCCGGCCCTGCCGCCCCGG + Intronic
1055397567 9:75891191-75891213 GGGAGCCGCTGCTGCTGCCCGGG + Exonic
1055514227 9:77020407-77020429 GGCCGCCGCCGCTGCCGCCGCGG + Exonic
1057146776 9:92764219-92764241 CCGCCCCGCCGGGGCCGCCCAGG + Intronic
1057207829 9:93184161-93184183 GCGCGGCTCCGCTCCCGCACCGG - Intergenic
1057245613 9:93451897-93451919 CCGCGCCCCCGCCGCCGCCATGG + Exonic
1057432229 9:95004938-95004960 GCCCGCCCGCGCCGCCGCCCAGG + Intronic
1057773160 9:97984461-97984483 GGGCGCCGCCGCCGCGGCACAGG - Intronic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1059234497 9:112750689-112750711 CCGAGGCGCCGCGGCCGCCCGGG - Intergenic
1059810602 9:117852124-117852146 GCCCGCCGGCCCTGCTGCCCCGG + Intergenic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060283502 9:122228900-122228922 GCGCGCAGCCCCGGCCTCCCTGG + Intronic
1060405956 9:123373261-123373283 GCGTGCCGCGGCGGGCGCCCTGG + Exonic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1060811771 9:126614365-126614387 GCTCTCCGCCGCCGCGGCCCTGG - Intergenic
1061275791 9:129568901-129568923 GCCCGCCCCCGCCGCCCCCCAGG + Intergenic
1061436905 9:130569470-130569492 GCTCGCAGCCTCTGCCTCCCTGG - Intergenic
1062218393 9:135401431-135401453 ACCCTCCGCTGCTGCCGCCCTGG - Intergenic
1062220211 9:135410998-135411020 GCCTGCCGCAGCTGCAGCCCGGG - Intergenic
1062314806 9:135961367-135961389 GCGCGCCGTCGCGGCCGCACCGG + Exonic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1062536596 9:137023785-137023807 GCCCCCCGCAGCTGCTGCCCAGG + Intronic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185877588 X:3713212-3713234 GCTCTCCGCCGCGGCCGCCTGGG + Exonic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1187670118 X:21658486-21658508 GCGCGCCGCCTCGGCCTCCCGGG + Intergenic
1187688372 X:21839490-21839512 GCGCTCGGGCGCTGCCGTCCAGG - Intergenic
1187900787 X:24025415-24025437 GCGGGCCGCGGGAGCCGCCCGGG + Intronic
1187915600 X:24149968-24149990 GCGCGCCTCCGCCGCCGCTCGGG - Intronic
1189821468 X:44873331-44873353 GAAAGCCGCCGCTGCCGACCCGG + Intronic
1192034320 X:67546339-67546361 CTGCGCCGCCGCAGCCGCCCAGG - Exonic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1196319550 X:114270823-114270845 GCCGGCCGGCCCTGCCGCCCTGG - Intergenic
1198388138 X:136147716-136147738 CCCCGCCGCCGCCGCCGCTCGGG + Intronic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1199976593 X:152898118-152898140 GCGCCCCGCGCCTGCCTCCCCGG + Intergenic
1200229397 X:154436760-154436782 GCGCGCCGCTGCGGCAGCCTGGG - Intergenic
1200292504 X:154886395-154886417 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200339348 X:155382135-155382157 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200347122 X:155458558-155458580 GGCCGGCGCCGCCGCCGCCCAGG + Exonic
1200418302 Y:2935619-2935641 GCGCACCTCCGCAGCCGCTCAGG - Exonic
1200787720 Y:7274332-7274354 GCTCTCCGCCGCGGCCGCCTGGG - Intergenic