ID: 944457697

View in Genome Browser
Species Human (GRCh38)
Location 2:199911936-199911958
Sequence AAGGGCGCCAAGGGCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944457697_944457712 15 Left 944457697 2:199911936-199911958 CCTTCCACGCCCTTGGCGCCCTT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 944457712 2:199911974-199911996 ATGGGGAAGGTGTCCGACGAGGG No data
944457697_944457703 -4 Left 944457697 2:199911936-199911958 CCTTCCACGCCCTTGGCGCCCTT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 944457703 2:199911955-199911977 CCTTTGTCCATAGAACCCCATGG 0: 1
1: 0
2: 1
3: 13
4: 134
944457697_944457711 14 Left 944457697 2:199911936-199911958 CCTTCCACGCCCTTGGCGCCCTT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 944457711 2:199911973-199911995 CATGGGGAAGGTGTCCGACGAGG No data
944457697_944457704 -3 Left 944457697 2:199911936-199911958 CCTTCCACGCCCTTGGCGCCCTT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 944457704 2:199911956-199911978 CTTTGTCCATAGAACCCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 94
944457697_944457706 2 Left 944457697 2:199911936-199911958 CCTTCCACGCCCTTGGCGCCCTT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 944457706 2:199911961-199911983 TCCATAGAACCCCATGGGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 165
944457697_944457705 -2 Left 944457697 2:199911936-199911958 CCTTCCACGCCCTTGGCGCCCTT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 944457705 2:199911957-199911979 TTTGTCCATAGAACCCCATGGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944457697 Original CRISPR AAGGGCGCCAAGGGCGTGGA AGG (reversed) Intronic
900299938 1:1971937-1971959 CAGGGCGCCAAGGGAGAGGCTGG + Intronic
900650579 1:3728150-3728172 ACCGGCACCAAGGGCGGGGACGG - Exonic
905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
911860406 1:102940405-102940427 AAGGTCCCCAAGGGCCTGCAGGG - Exonic
917329696 1:173868550-173868572 CCGGGGGCCAAGGGGGTGGAAGG - Intronic
1065962183 10:30742662-30742684 AAGGGCTGCCAGGGCGTGGGAGG - Intergenic
1068620627 10:59177175-59177197 AAGGGCGCCACGGTTGTGGACGG - Intronic
1069286458 10:66721180-66721202 AAGAGACCCAAGGGTGTGGAAGG + Intronic
1069636747 10:69929717-69929739 AAGGGAGCCAAGGGCGCCTAGGG + Intronic
1072537698 10:96375683-96375705 ATGGGCCCCCAGGGCGTCGAGGG - Intronic
1074455262 10:113590544-113590566 AAGGGCCTCAAGGGAGTGGGTGG + Intronic
1076022167 10:127082816-127082838 AAGGGAGCCAAGGGAGTGTGAGG - Intronic
1076146548 10:128126525-128126547 AAGGGAGCGCAGGGCGTGGGCGG + Intergenic
1077196460 11:1283314-1283336 AAGGGAGGCAAGGCCATGGAGGG + Intronic
1077914701 11:6603731-6603753 AAGAGCGCCACGGGCGGGGCGGG + Intronic
1080764529 11:35282965-35282987 AAGTGAGCCAGGGGAGTGGAAGG - Intronic
1083302188 11:61745106-61745128 AAGGCAGCCAGGGGCCTGGAGGG + Exonic
1084218813 11:67665663-67665685 GAGGGCTCCCTGGGCGTGGAAGG + Exonic
1084322858 11:68383390-68383412 AAGGTCCCCAAGGGCTTGGCCGG - Intronic
1084774817 11:71368351-71368373 AAGAGCGCCAAGGGTGAGCAGGG + Intergenic
1090256114 11:125285849-125285871 AAGAGCCTCAAGGGCATGGATGG - Intronic
1090653569 11:128825947-128825969 AAGGGACCCCAGGGCATGGAAGG + Intergenic
1096114070 12:49044856-49044878 AGCGGCGCCAACGGCGAGGACGG - Exonic
1097063176 12:56300741-56300763 AAGCGCGCCAAGGCGGTAGAAGG - Intronic
1113450852 13:110408229-110408251 AAGGGTCCCCAGGGCGGGGAGGG + Intronic
1114656170 14:24316786-24316808 AGGGGCGTGGAGGGCGTGGAGGG + Exonic
1115028502 14:28767760-28767782 GAGGGCGGCAAGGACGGGGAGGG + Exonic
1120991726 14:90383255-90383277 CAAGCCGCGAAGGGCGTGGAGGG - Intergenic
1122370411 14:101226228-101226250 GAGGTCGGCAAGGTCGTGGAAGG + Intergenic
1122969083 14:105145182-105145204 AAGGATGCCAAGGGCCTGGGGGG + Intronic
1125510718 15:40291121-40291143 GAGGGCCCTGAGGGCGTGGACGG - Exonic
1126114595 15:45197457-45197479 AAGGGGGACACGGGAGTGGAGGG + Intronic
1126137023 15:45402533-45402555 GCGCGCGCCCAGGGCGTGGAGGG - Exonic
1127509294 15:59624360-59624382 TAGGAAGCCAAGGGGGTGGATGG - Intronic
1128544675 15:68559039-68559061 AACGGCGCCTAGCGCGTGGTAGG - Intergenic
1128582332 15:68818748-68818770 AAGGGCGCCAAGCGCGGGGCCGG - Intronic
1129130289 15:73487596-73487618 TTGGGCTCCAAGGGCCTGGAAGG + Intronic
1129983615 15:79897016-79897038 GAGGGCGCCCAGGGCGCCGAGGG - Exonic
1132337120 15:101055146-101055168 GAGGGCGCCCTAGGCGTGGAGGG + Exonic
1133998997 16:10768087-10768109 AAAGGAGCCAGGGGTGTGGAAGG + Exonic
1135324926 16:21520265-21520287 ATGGCCGCCAAGCGCGCGGACGG - Intergenic
1136342957 16:29656871-29656893 CCGGGTGGCAAGGGCGTGGATGG + Intergenic
1137270606 16:46900256-46900278 GAGGGGGCCTAGGGCGTTGAGGG + Intronic
1138449508 16:57084946-57084968 AGGGGAGCCAAGGCCGAGGAAGG + Intergenic
1140912730 16:79468435-79468457 GAGGGAGCCAAGTCCGTGGAGGG + Intergenic
1141456367 16:84145049-84145071 GAGGGCGCCCAGGGCGCGGGGGG + Intronic
1142683220 17:1562305-1562327 AGGGGCGGCCGGGGCGTGGAGGG - Intronic
1142683229 17:1562324-1562346 AGGGGCGGCCGGGGCGTGGAGGG - Intronic
1147167489 17:38601300-38601322 AAGGGGCCCCAGGGCGTGGATGG + Intronic
1147425560 17:40344440-40344462 AAGGTGGCCAAGGCAGTGGAAGG - Intronic
1154287479 18:13073750-13073772 AAGGGCACCAAGCCCGTGCATGG + Intronic
1158954765 18:62526846-62526868 AAGGGCGCCGGGGGCGGGGCCGG - Intronic
1160453579 18:78980609-78980631 AAGGGCGCCGAGGCCGCGGCCGG + Intronic
1161152355 19:2716474-2716496 AGAGGCACCATGGGCGTGGAGGG - Exonic
1161194323 19:2977678-2977700 AGGGGCTGCAGGGGCGTGGAGGG + Intronic
1162296937 19:9819684-9819706 CCAGGCGCCAAGGGCGTGGCTGG + Intronic
1163648971 19:18506098-18506120 ATGGGCACCCAGGGCTTGGAGGG - Intronic
1166299106 19:41904150-41904172 CAGTGAGCCAAGGGCGGGGAGGG + Intronic
1166435659 19:42764861-42764883 AAAAACACCAAGGGCGTGGAGGG - Intronic
1168564318 19:57410930-57410952 CGGGGCTCCAAGGACGTGGAGGG - Intronic
927501216 2:23584558-23584580 AATGTCGCCAAAGGCTTGGAGGG - Intronic
934577594 2:95412789-95412811 AAGGGCCCCAAAGGCCTGGCAGG + Intronic
934793764 2:97083899-97083921 AAGGGCCCCAAAGGCCTGGCAGG - Intronic
942085265 2:172437742-172437764 GAGGGCACCAAGGACGGGGATGG + Intronic
944457697 2:199911936-199911958 AAGGGCGCCAAGGGCGTGGAAGG - Intronic
1170885136 20:20334082-20334104 AAGGGAGCCCAGGGTGTGGGAGG + Intronic
1171036103 20:21714124-21714146 AAGGGCGCAGAGGGCTGGGAAGG - Intronic
1171970630 20:31562838-31562860 AAGGGCTTCAATGGCGTGTAAGG + Intronic
1172027214 20:31956796-31956818 AAGGGTGCAAAGGAAGTGGAGGG - Intergenic
1179185995 21:39085725-39085747 AGGGGTGGCAAGGGCTTGGAGGG - Intergenic
1180056137 21:45360091-45360113 AAGGGCGGCAGGGCCGGGGAAGG - Intergenic
1180618794 22:17146286-17146308 GAGGGCGCCACAGGTGTGGAGGG - Intronic
1181022797 22:20112501-20112523 CAGGGCCCCAGGGGCGGGGAAGG - Exonic
952872888 3:37917888-37917910 AAGGACCCCAAGGGCGTAGCAGG + Intronic
953057059 3:39396457-39396479 AATGGCAGCAATGGCGTGGACGG + Exonic
953154057 3:40352931-40352953 AGGGGCACCAAGGAAGTGGAAGG - Intergenic
953413029 3:42700943-42700965 AAGGTCCCCAAGGGGCTGGAGGG - Intronic
959327559 3:104956737-104956759 AAGGGCGCCGAGGGCGAGCCTGG + Intergenic
959761176 3:109967070-109967092 AAGGGCGGCAAGGACATGGGTGG - Intergenic
960699284 3:120425011-120425033 GAGGGCGGCTAGGGCGTGGAAGG + Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
964593288 3:158391540-158391562 AAGGGAGCCAAGGGCTTTAAGGG - Intronic
970427850 4:15962482-15962504 AAAGGCGCACAGGGCCTGGAAGG + Exonic
975605291 4:76148504-76148526 GAAGGCGCCAAGGGCGTAGGAGG + Exonic
975840466 4:78468646-78468668 AATGGCGGCAAGGGAATGGAAGG - Intronic
978189399 4:105895375-105895397 AGGGGCGCCAGGGGCGGGCAGGG - Intronic
995650374 5:114362248-114362270 AGGGGCGCGAAGGGCGGGCACGG - Exonic
1002209180 5:177585837-177585859 AAGGGTGCGAAGGGGGTTGAGGG - Intergenic
1006133477 6:31882407-31882429 AAGGGCGAGGAGGGGGTGGAGGG + Intronic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1009995218 6:70889125-70889147 AAGGAAGCCAAGGGCTGGGAAGG - Intronic
1019087734 6:169497271-169497293 AAGTGCGCCAAAGGCCTGAATGG + Intronic
1019111993 6:169724158-169724180 GAGGGCGCCAAAGGCTGGGAGGG + Intronic
1023150427 7:37196570-37196592 AAGGACTCCAAGGGAGTGGGGGG + Intronic
1024454042 7:49582474-49582496 AAGGGCTGCAAGGGCATGGAAGG - Intergenic
1026909356 7:74083586-74083608 AAGGGCGGAAGGGGCGGGGAGGG + Intronic
1027107776 7:75416199-75416221 GCGGGCGCCAGGGTCGTGGAGGG + Intergenic
1029436024 7:100564485-100564507 AAGGGAGCCAAGGGCAGGGCTGG - Intronic
1029497390 7:100903385-100903407 AAGTGCGCCCAGGACGAGGATGG - Intergenic
1033438401 7:141355276-141355298 AAGGGAGTCAAAGGGGTGGATGG + Intronic
1035329099 7:158084922-158084944 ATGGGCGTCGAGGGTGTGGATGG - Intronic
1035329131 7:158085049-158085071 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329145 7:158085103-158085125 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329156 7:158085141-158085163 ATGGGCGTCGAGGGTGTGGATGG - Intronic
1035329169 7:158085191-158085213 ATGGGCGTCAAGGGTGTGGATGG - Intronic
1035329202 7:158085332-158085354 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329220 7:158085403-158085425 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329242 7:158085492-158085514 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329250 7:158085527-158085549 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329261 7:158085565-158085587 ATGGGCGTCGAGGGTGTGGATGG - Intronic
1035329274 7:158085615-158085637 ATGGGCGTCGAGGGTGTGGATGG - Intronic
1035329308 7:158085756-158085778 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329326 7:158085827-158085849 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035329348 7:158085917-158085939 ATGGGCGTCATGGGTGTGGATGG - Intronic
1035628008 8:1088324-1088346 CAGGGCACCAAGGGCCTGGTGGG + Intergenic
1039887568 8:41663899-41663921 CAGGGCTCCCAGGGCGTGGGCGG + Intronic
1045430979 8:102114805-102114827 AAGGGAGCCAGGGATGTGGAAGG + Intronic
1047097621 8:121641392-121641414 AAGGGCAACAACGGCGGGGAAGG - Intergenic
1058925178 9:109656224-109656246 AAGGGCGCCATGGTGGTGGAAGG + Intronic
1059405865 9:114098193-114098215 GCGGGCGGCAAGGGCGTGGCTGG + Intronic
1061572964 9:131489009-131489031 AAGGGCACCAGTGGCGAGGAGGG - Intronic
1061942799 9:133892123-133892145 AAGGGACCCAAGGGCGGGGTGGG + Intronic
1062373950 9:136253700-136253722 AGGGGCCCCGAGGGCGGGGAAGG + Intergenic
1062428273 9:136516013-136516035 AATGGTGCCAAGTGCCTGGACGG - Exonic
1185894321 X:3844066-3844088 AGGGGCGCCTCGGGCGCGGAGGG - Intergenic
1185899440 X:3882490-3882512 AGGGGCGCCTCGGGCGCGGAGGG - Intergenic
1185904557 X:3920919-3920941 AGGGGCGCCTCGGGCGCGGAGGG - Intergenic
1187393956 X:18904066-18904088 AATGGAGCCATGGGAGTGGAGGG + Intronic
1195522961 X:105851741-105851763 AAGGGCACCATGGGAGGGGAGGG + Intronic
1195705986 X:107738417-107738439 AAGGACGCCAAGGGAGTTGGTGG + Intronic