ID: 944460332

View in Genome Browser
Species Human (GRCh38)
Location 2:199942355-199942377
Sequence TGCAAAAGGCTGGCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2228
Summary {0: 1, 1: 1, 2: 16, 3: 185, 4: 2025}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944460332_944460339 12 Left 944460332 2:199942355-199942377 CCGCGCCCGGCCAGCCTTTTGCA 0: 1
1: 1
2: 16
3: 185
4: 2025
Right 944460339 2:199942390-199942412 TCTCAGCATCTGCTTCTTAGAGG 0: 1
1: 5
2: 19
3: 73
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944460332 Original CRISPR TGCAAAAGGCTGGCCGGGCG CGG (reversed) Intronic
Too many off-targets to display for this crispr