ID: 944461545

View in Genome Browser
Species Human (GRCh38)
Location 2:199955434-199955456
Sequence CCTCCCGGTACCCCGGCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944461545_944461551 -7 Left 944461545 2:199955434-199955456 CCTCCAGCCGGGGTACCGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 944461551 2:199955450-199955472 CGGGAGGTGCTGCCCGGCCATGG 0: 1
1: 0
2: 1
3: 18
4: 217
944461545_944461555 18 Left 944461545 2:199955434-199955456 CCTCCAGCCGGGGTACCGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 944461555 2:199955475-199955497 GCTCACGCCTGCCCTCTTCCAGG 0: 1
1: 0
2: 4
3: 32
4: 331
944461545_944461557 25 Left 944461545 2:199955434-199955456 CCTCCAGCCGGGGTACCGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 944461557 2:199955482-199955504 CCTGCCCTCTTCCAGGTCTTCGG 0: 1
1: 0
2: 2
3: 46
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944461545 Original CRISPR CCTCCCGGTACCCCGGCTGG AGG (reversed) Exonic
900737439 1:4308044-4308066 TCTCCTGGTCCCCAGGCTGGCGG + Intergenic
902608022 1:17580078-17580100 CCTTCCGGTAGCCCTGCTGAAGG - Intronic
903466330 1:23554783-23554805 CCTCCCGGTTCCCAGCCTCGCGG - Intergenic
907237396 1:53061923-53061945 CTTCCCGGTCTCCCGGGTGGGGG + Intergenic
907326756 1:53643368-53643390 CCTCCAGGTAACCCTGCGGGTGG + Intronic
910963426 1:92785013-92785035 CCTCCCGGCACCGCCGCTGTCGG + Intronic
915113124 1:153577439-153577461 CCTCTCTCTACCCCAGCTGGTGG + Intergenic
916127993 1:161588493-161588515 CCTCCCAGTGCCCTGTCTGGAGG + Intronic
916137911 1:161670323-161670345 CCTCCCAGTGCCCTGTCTGGAGG + Intronic
919752792 1:201048675-201048697 TCTCCCTGTACAGCGGCTGGTGG - Exonic
919823316 1:201486416-201486438 ACTCCCAGTGCCCAGGCTGGTGG + Intronic
924025053 1:239823416-239823438 CCTCCCTGGACCAAGGCTGGGGG - Intronic
924436727 1:244049041-244049063 CGCCCCGGCACCCCGGCGGGCGG + Intronic
1064424776 10:15220968-15220990 CCACCCAGTACCCCAACTGGGGG + Exonic
1065188732 10:23192425-23192447 CCTCCCGGGGCCCTGGCTGGGGG - Exonic
1077406155 11:2383399-2383421 CCTGCAGGGACCCAGGCTGGAGG + Intronic
1077487640 11:2846382-2846404 CCTCCAGGTACCCACGGTGGGGG + Intronic
1080821553 11:35811727-35811749 CCTCCAGATACACCTGCTGGTGG - Exonic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081709674 11:45208775-45208797 CCTCCTGGCTCCCCAGCTGGGGG + Intronic
1081920530 11:46771440-46771462 ACTCCCGTCACCCAGGCTGGAGG + Intronic
1082026802 11:47578631-47578653 CCTCCCAGTGCCCCGGCCTGGGG - Intronic
1084261886 11:67984259-67984281 ACTCCCCGTACCCCGGGTGGGGG + Intergenic
1084429989 11:69105759-69105781 CGTCCTGGGACCCAGGCTGGTGG - Intergenic
1084595049 11:70111906-70111928 CTTCCCTGTTCCCCGGGTGGGGG + Intronic
1085618107 11:78017205-78017227 CCTCAGGGTACCCAGGGTGGTGG + Exonic
1087141345 11:94768569-94768591 CCTCCCGGCACCTCGAGTGGGGG - Intronic
1089567835 11:119381443-119381465 CCTCCCGGATCCCCGACAGGTGG + Intronic
1089813851 11:121154651-121154673 CCTAGCGGTACCACTGCTGGAGG + Intronic
1090832163 11:130427528-130427550 CCTCCGGGCACGGCGGCTGGAGG + Intronic
1093727538 12:22532295-22532317 ACTCCCGTTGCCCAGGCTGGAGG - Intronic
1094040968 12:26122113-26122135 TCTCCGGGTTCCCCGGCTCGCGG + Exonic
1096103962 12:48985961-48985983 CCTCCCTGGGCCCTGGCTGGAGG + Intergenic
1100369264 12:93951117-93951139 CCTCCTGTCACCCAGGCTGGAGG - Intergenic
1102047628 12:109839842-109839864 CCTCCCCTTAGCCCAGCTGGGGG + Intergenic
1102564574 12:113787204-113787226 CCTCCCAGAACCCTGGCTGATGG - Intergenic
1103329005 12:120140853-120140875 ACTCACGGCATCCCGGCTGGTGG + Exonic
1104119918 12:125789311-125789333 CCTTCTGTTACCCAGGCTGGAGG - Intergenic
1105291279 13:19055303-19055325 CATCCCGGTACCTGGGGTGGAGG - Intergenic
1105299314 13:19118182-19118204 CCACCCAGTGCCCCGGATGGCGG + Intergenic
1106036901 13:26051708-26051730 GCTCCCGGGACTGCGGCTGGGGG - Intergenic
1108001638 13:45910105-45910127 CATCCCCGTAGCCTGGCTGGGGG - Intergenic
1112507432 13:99983229-99983251 CATCCCAGGTCCCCGGCTGGCGG - Intronic
1119378803 14:74215633-74215655 CCTCCCAGGACCATGGCTGGGGG - Intergenic
1121311501 14:92937813-92937835 CCTCCCGGTCACCAGGCTGGAGG + Exonic
1122519686 14:102334556-102334578 CCTCCCGGTCACACTGCTGGAGG - Exonic
1122693894 14:103543673-103543695 CCTCCCTGTACCCTGTCTTGAGG + Intergenic
1125760683 15:42093809-42093831 CCCCCCGGTGCCCCAGGTGGTGG - Intronic
1129739162 15:77981634-77981656 CCTCCCGTGGCCCAGGCTGGGGG + Intergenic
1130957702 15:88639124-88639146 CTTCCCGGTCCCCAGGCTGCGGG + Intronic
1132719842 16:1310067-1310089 CCTCGCGGGGCCCCGGCTGCAGG - Intronic
1133013007 16:2925269-2925291 CCTCGCGGGACCTGGGCTGGGGG + Intronic
1133505612 16:6409379-6409401 GCTCCCGTTGCCCTGGCTGGAGG - Intronic
1133559143 16:6933994-6934016 CCTCCCTGACCCCTGGCTGGTGG - Intronic
1134043507 16:11085189-11085211 CCTCCTGGAACCCAGGGTGGGGG - Intronic
1134550344 16:15135957-15135979 GCGCCGGGCACCCCGGCTGGTGG + Intronic
1141626422 16:85263978-85264000 CCTCCCCGGCCCCAGGCTGGAGG - Intergenic
1142185063 16:88690956-88690978 CCTCCTGGTGCCCAGGCTGCAGG + Intergenic
1142688527 17:1591501-1591523 CTGCCCGGGACCCCGGCTGGGGG + Intronic
1143103220 17:4515205-4515227 CATCCCGGTGGCCTGGCTGGAGG + Intronic
1143321461 17:6071310-6071332 CCTCCGGGTAACCTCGCTGGTGG + Intronic
1145796845 17:27660562-27660584 CCTCCAGGTGCCCTGTCTGGTGG + Intergenic
1147995124 17:44355982-44356004 CCACCCAGTACCCCAGCTGGGGG + Exonic
1148790538 17:50170274-50170296 CCTCCTGGTGCCCCTGCTGGTGG + Exonic
1148860208 17:50600667-50600689 CCTCCAGGTTCCCCGGCTCCTGG - Intronic
1149491075 17:57085502-57085524 CCTCCAGGTACCCCGGGGGCGGG + Intronic
1150259217 17:63774504-63774526 CTTCCCGGCACCCCGGCCGCCGG - Intronic
1151328141 17:73391405-73391427 CCTTCCCGTGCCCCGGCTGCAGG - Intronic
1151542833 17:74773532-74773554 CCTCCCAGTACCAGGGCTAGGGG + Intronic
1152552217 17:81035452-81035474 CCACCCGGGACCCGGGCTGCTGG + Intronic
1152637950 17:81437872-81437894 CCTCCCCCGACCCTGGCTGGAGG - Intronic
1152662837 17:81550934-81550956 TTTCCTGGGACCCCGGCTGGGGG + Exonic
1152738545 17:82009030-82009052 GCTCCCGGTCCACGGGCTGGAGG - Exonic
1160025101 18:75209766-75209788 CCTCCCGCTCCCCAGGCTGGTGG + Intergenic
1161264976 19:3359857-3359879 CCCCCCCGCACCCCGGCTGGGGG + Intronic
1161766827 19:6212998-6213020 CCTCCCAGGACCCCGGCGGTGGG + Exonic
1161979755 19:7624273-7624295 CCTCTGGGGGCCCCGGCTGGTGG - Intronic
1163370641 19:16899449-16899471 CCTCCACCAACCCCGGCTGGTGG + Intronic
1164679467 19:30124085-30124107 CCTCCCCACACCCCCGCTGGAGG - Intergenic
1165889273 19:39100847-39100869 CCTCCAGGTAACCTGGGTGGAGG + Exonic
1166558952 19:43719395-43719417 CCTGCCGGTCCCAGGGCTGGCGG + Exonic
1166571038 19:43797605-43797627 CCTCCCAGTCCTCCTGCTGGTGG - Exonic
925047011 2:780243-780265 CCTGCCGGGACCCCTGCTGCTGG + Intergenic
925369491 2:3334172-3334194 CCTGCCGGTGCCTGGGCTGGTGG - Intronic
928127681 2:28627626-28627648 ACTCCCAGTACCCCTTCTGGTGG + Intronic
928358306 2:30641038-30641060 CCTCCAGGTACTCAGGCAGGTGG + Exonic
930730417 2:54723614-54723636 GCCCCCGGAGCCCCGGCTGGAGG + Intronic
934047703 2:88186113-88186135 CCTCCCAGTAGCCTGGCTGGAGG + Exonic
936475488 2:112835997-112836019 CCTCCAGGTCCCAAGGCTGGAGG + Intronic
942155002 2:173119320-173119342 CCTCCCAGCACCCCAGCAGGTGG - Intronic
944461545 2:199955434-199955456 CCTCCCGGTACCCCGGCTGGAGG - Exonic
947658624 2:231849775-231849797 CCTCAGGGGACCCAGGCTGGAGG + Intergenic
1168898109 20:1337924-1337946 CCCCCAGGTAGCCTGGCTGGTGG + Intronic
1172959322 20:38787412-38787434 CCTGCCTGTCCCCAGGCTGGAGG + Intergenic
1175890780 20:62314992-62315014 CCTCGCGGTGCCCCTGATGGAGG - Intronic
1176118868 20:63445278-63445300 GCTGCCGGTACCGTGGCTGGAGG - Exonic
1178954015 21:37007029-37007051 CCTCCCGGGAACCCGGCTGCCGG - Intronic
1180339661 22:11607520-11607542 CCTCTTGTTACCCAGGCTGGAGG - Intergenic
1183383150 22:37500508-37500530 CCTCCCGGCACCCAGGCTCCAGG + Intronic
1183483059 22:38075354-38075376 CCTCCCGGCTCCCCGGCCAGAGG + Exonic
1184118571 22:42436169-42436191 CCTCACTGTGTCCCGGCTGGAGG - Intergenic
961655383 3:128438884-128438906 CCTGCCGCTGCCCCTGCTGGAGG - Intergenic
966379033 3:179325052-179325074 ACTCCTGTTACCCAGGCTGGAGG + Exonic
966993059 3:185253910-185253932 CCGCACGGTCCCCGGGCTGGAGG + Intronic
969331927 4:6478839-6478861 CTTCCCGGGACCCCGGCTGATGG + Intronic
991987884 5:72308445-72308467 CCTCACGGCCCTCCGGCTGGCGG + Intronic
997727414 5:136133113-136133135 CCTGCCGGGGTCCCGGCTGGCGG + Intronic
999240204 5:150123031-150123053 CCTCCTGGTACCTGGGCAGGGGG + Exonic
1002058084 5:176610085-176610107 CCTCCCGCCAGCCCGGCCGGAGG - Exonic
1002064885 5:176647153-176647175 CCGCCCGGGACGCCGGCTGATGG - Intergenic
1002065626 5:176650329-176650351 CCTCCAGGAACTCCTGCTGGAGG + Intronic
1002585095 5:180240620-180240642 GCTCCTGGTTCCCCCGCTGGAGG - Intronic
1003101134 6:3177340-3177362 CCTCTCGGTCCACCAGCTGGTGG - Intergenic
1003107088 6:3225509-3225531 CCTCTCGGTCCACCAGCTGGTGG - Exonic
1003192350 6:3885792-3885814 CCTCCAGGTCCCCCAGCAGGTGG + Intergenic
1003552132 6:7108851-7108873 CCTCGCGGGTTCCCGGCTGGCGG + Intronic
1004220996 6:13746159-13746181 ACTCTCGTTACCCAGGCTGGAGG - Intergenic
1005311896 6:24566715-24566737 CCTCCCAGAGCCCGGGCTGGTGG - Exonic
1005798309 6:29391342-29391364 CCTCCCGTTACCCCGACCAGAGG - Intronic
1006405890 6:33844628-33844650 CCTCCCGGCACCCCTGTTGAGGG + Intergenic
1006457656 6:34141205-34141227 CCTCCTGGTTCCCATGCTGGTGG + Intronic
1007264768 6:40587884-40587906 CCTCCCGGTTCCGGGGCTCGCGG - Intergenic
1007341678 6:41194598-41194620 CCTCCTGGGTCCCTGGCTGGTGG + Exonic
1007790753 6:44306825-44306847 CCTCTGGGCACCCAGGCTGGGGG + Intronic
1015567947 6:134593221-134593243 CCTCCCGGGACCCTGGCAGGAGG - Intergenic
1017943636 6:159075888-159075910 CATCCCAGGACCCCGGCTGATGG - Intergenic
1019471837 7:1225198-1225220 CGTCCCGGTGCCCGGGGTGGGGG + Intergenic
1019476622 7:1247553-1247575 CCTGCCGGTCCCCAGCCTGGGGG + Intergenic
1019517342 7:1445887-1445909 CCACCCTGCACCCCGGGTGGGGG - Intronic
1019578690 7:1749653-1749675 CCTCCCGGGACCCCTCATGGAGG - Intergenic
1020125143 7:5529441-5529463 CCTCCCGGTTTCCGGGGTGGGGG - Intronic
1023390107 7:39701477-39701499 ACTCCCATTACCCAGGCTGGAGG - Intronic
1032197932 7:129799929-129799951 AGTCCTGGCACCCCGGCTGGTGG - Intergenic
1032329263 7:130962502-130962524 CCTCCCAGTGCACAGGCTGGTGG + Intergenic
1034467681 7:151239422-151239444 CCTCCTGGGACCAGGGCTGGTGG + Exonic
1036692086 8:10950384-10950406 CCTCCCTGTGCCAGGGCTGGGGG + Intronic
1039802425 8:40970850-40970872 CCTCCCAGTGCTCAGGCTGGTGG + Intergenic
1041244856 8:55880174-55880196 GCGCCCGGGACTCCGGCTGGTGG - Intronic
1042229276 8:66540479-66540501 ACCCCCGGTACCCCGTGTGGAGG - Intergenic
1045294793 8:100863501-100863523 ACTCCTGGTTCTCCGGCTGGCGG + Intergenic
1046936659 8:119891076-119891098 CATCCAAGTACCCAGGCTGGAGG + Intronic
1049145877 8:141000942-141000964 CCTCCCAGAACCCGGGCCGGGGG + Intronic
1049382585 8:142324888-142324910 CCTGCCGGTCCCTCGGCTGAGGG + Intronic
1051840012 9:21385222-21385244 CCTCCTGCTACCCAGGCTGTGGG + Exonic
1054820484 9:69516285-69516307 CGTCCCCCTACCCCGGCCGGGGG - Exonic
1056531093 9:87488487-87488509 CCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1057191244 9:93088797-93088819 TCACCAGGGACCCCGGCTGGTGG + Intergenic
1057942418 9:99296622-99296644 CCTCCCCGCACCCCTTCTGGTGG - Intergenic
1061217091 9:129227706-129227728 CCTCCCAGCACCCCCGGTGGAGG + Intergenic
1061621270 9:131812707-131812729 CCTCCCTGTGCCCGGGCTGCCGG + Intergenic
1061880904 9:133568434-133568456 CCTGCCGGAACCCCGCCTGCGGG + Exonic
1061921943 9:133787372-133787394 CCCCCCAGTGCCCAGGCTGGGGG + Intronic
1062032144 9:134366537-134366559 CCTCCAGGTCCCCCGGGTGCTGG + Intronic
1062506988 9:136882610-136882632 CCTCCCCCTGCCCCTGCTGGAGG + Intronic
1062577889 9:137217043-137217065 CCTCCCGGTGCCCTGGGTGCTGG + Intergenic
1062577904 9:137217094-137217116 CCTCCCGGTGCCCTGGGTGCTGG + Intergenic
1062577920 9:137217145-137217167 CCTCCCGGTGCCCTGGGTGCTGG + Intergenic
1062723755 9:138059371-138059393 CCTCCCAGGACCTAGGCTGGGGG - Intronic
1190228446 X:48563177-48563199 CCTCCAGACACCCGGGCTGGTGG + Intergenic
1190543328 X:51499701-51499723 GCTCCTGTTACCCAGGCTGGAGG - Intergenic