ID: 944463251

View in Genome Browser
Species Human (GRCh38)
Location 2:199974469-199974491
Sequence GGTTGAGTGAGACCATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944463251_944463258 15 Left 944463251 2:199974469-199974491 CCAGAACATGGTCTCACTCAACC No data
Right 944463258 2:199974507-199974529 GTACAAATCTGCCATGTTCCTGG No data
944463251_944463254 -10 Left 944463251 2:199974469-199974491 CCAGAACATGGTCTCACTCAACC No data
Right 944463254 2:199974482-199974504 TCACTCAACCATAGGGACCCAGG No data
944463251_944463262 26 Left 944463251 2:199974469-199974491 CCAGAACATGGTCTCACTCAACC No data
Right 944463262 2:199974518-199974540 CCATGTTCCTGGAAGGCAGAGGG No data
944463251_944463260 25 Left 944463251 2:199974469-199974491 CCAGAACATGGTCTCACTCAACC No data
Right 944463260 2:199974517-199974539 GCCATGTTCCTGGAAGGCAGAGG No data
944463251_944463259 19 Left 944463251 2:199974469-199974491 CCAGAACATGGTCTCACTCAACC No data
Right 944463259 2:199974511-199974533 AAATCTGCCATGTTCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944463251 Original CRISPR GGTTGAGTGAGACCATGTTC TGG (reversed) Intronic
No off target data available for this crispr